View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18415_low_36 (Length: 280)
Name: NF18415_low_36
Description: NF18415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18415_low_36 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 16 - 264
Target Start/End: Original strand, 20841980 - 20842228
Alignment:
| Q |
16 |
catctttgaacaacactaccactaacaccagtcacagtctcccacaaaacctcctcagcatacttcgaattcacaactcctccgccggtaaacaccgcct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20841980 |
catctttgaacaacactaccactaacaccagtcacagtctcccacaaaacctcctcagcatacttcgaattcacaactcctccgccggtaaacaccgcct |
20842079 |
T |
 |
| Q |
116 |
tttcaaaaacactactcccatttggtagattcaccataaacttaaccaaactctctccaccacaacacaaaccatacaaactcctattattattataatt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
20842080 |
tttcaaaaacactactcccatttggtagattcaccataaacttaaccaaactctcaccaccacaacacaaaccatacaaactcctattattattaaaatt |
20842179 |
T |
 |
| Q |
216 |
actactactattaccataactcttccaaccatcactagctacttgaaaa |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20842180 |
actactactattaccataactcttccaaccatcactagctacttgaaaa |
20842228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University