View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18415_low_43 (Length: 243)
Name: NF18415_low_43
Description: NF18415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18415_low_43 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 41314440 - 41314221
Alignment:
| Q |
1 |
agacgagcggaaatcaatggcagcgaaatgagcaagaatatcatgaagattaacaaagataataatggtaagagcaataagaagaacaacgaggcccgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41314440 |
agacgagcggaaatcaatggcagcaaaatgagcaagaatatcatgaagattaacaaagataataatggtaagagcaataagaagaacaacgaggcccgaa |
41314341 |
T |
|
| Q |
101 |
cgggcttcaggagaaagctgggccacaaaaccggaacaaaggatcacggtggcaaatagatataggcctgcgtttatgtattcgtaacggtttctagtga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41314340 |
cgggcttcaggagaaagctgggccacaaaaccggaacaaaggatcacggtggcaaatagatataggcctgcgtttatgtattcgtaacggtttctagtga |
41314241 |
T |
|
| Q |
201 |
ggcccgggccgtatgtacgg |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
41314240 |
ggcccgggccgtatgtacgg |
41314221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University