View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18415_low_46 (Length: 238)
Name: NF18415_low_46
Description: NF18415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18415_low_46 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 17 - 216
Target Start/End: Complemental strand, 9805578 - 9805378
Alignment:
| Q |
17 |
atatcaaataaggaaaacaaggtgatatatatgtggcttactttttagatttttccattgatttgagaaatataaaagttaatagttatgcctcataaaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9805578 |
atatcaaataaggaaaacaaggtgat-tatatgtggcttactttttagatttttccattgatttgagaaatataaaagttaatagttatgcctcataaaa |
9805480 |
T |
 |
| Q |
117 |
ctataatttattatttgtcaat--nnnnnnnnnnctataatttataactcttgcaccgactatataagaataccgttcatttgtaggcacagatgcaacc |
214 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9805479 |
ctataatttattatttgtcaataaaaaaaaaaaactataatttataactcttgcaccgactatataagaataccgttcatttgtaggcacagatgcaacc |
9805380 |
T |
 |
| Q |
215 |
ta |
216 |
Q |
| |
|
|| |
|
|
| T |
9805379 |
ta |
9805378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University