View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18415_low_49 (Length: 232)
Name: NF18415_low_49
Description: NF18415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18415_low_49 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 13 - 232
Target Start/End: Complemental strand, 4337570 - 4337352
Alignment:
| Q |
13 |
tcttctctaggtatcgaagttgaattccccaagtactaaaaattcttgtgttgggcccaatggagatacaaagctttgttcttgtagcaattggggcccc |
112 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| |||||||||||| |||| |
|
|
| T |
4337570 |
tcttctctaggtatcgaatttgaattccccaagtaccaaaaattcttgtgttgggccgctcc---atacaaagctttgttctggtagcaattgggccccc |
4337474 |
T |
|
| Q |
113 |
c-gctagtggttagtgggatttatccccc-ggattagttggtccttaggccggatatggagttttcaagagnnnnnnntcagctcaaattaaaatttacc |
210 |
Q |
| |
|
| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4337473 |
ccgctagtggttagtgggatttatccccccggattagttggtccttaggccggatatggagttttcaagagaaaaaaatcagctcaaattaaaatttacc |
4337374 |
T |
|
| Q |
211 |
tggcaagtctttcacatctttc |
232 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
4337373 |
tggcaagtctttcacatctttc |
4337352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University