View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18417_high_51 (Length: 241)
Name: NF18417_high_51
Description: NF18417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18417_high_51 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 5 - 225
Target Start/End: Complemental strand, 10383105 - 10382893
Alignment:
| Q |
5 |
gtgagaaagtgagcgtgatagtgatgaggttattatatggtttgaattttgcatgtaaataattgcatgaaatttgcaacatttgtgggtatattattat |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10383105 |
gtgagaaagtgagcgtgatagtgatgaggttattatatggtttgaattttgcatgtaaataattgcatgaaatttgcaacatttgtgggtatattattat |
10383006 |
T |
 |
| Q |
105 |
gtgtgtgctctattattgtggaaaaggaaaagctatatggaatgtgggaatggtataggatgtttgatttgagaattttgcatatgatggtgtctaaaaa |
204 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
10383005 |
gtgtgtgcgctattattgtggaaaaggaaaagatatatgg--------aatggtataggatgtttgatttgagaattttgcatatgatgttgtctaaaaa |
10382914 |
T |
 |
| Q |
205 |
gaaaagaattttggatatgat |
225 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
10382913 |
gaaaagaattttggatatgat |
10382893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University