View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18417_low_36 (Length: 328)
Name: NF18417_low_36
Description: NF18417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18417_low_36 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 19 - 314
Target Start/End: Complemental strand, 14472746 - 14472451
Alignment:
| Q |
19 |
ggagctatttgtgagttcattggttcatttgctttatgggttttacatatttagttcagctgttgctggagatctatcaattgttgttaatgaatatttt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14472746 |
ggagctatttgtgagttcattggttcatttgctttatgggttttacatatttagttcagctgttgctggagatctatcaattgttgttaatgaatatttt |
14472647 |
T |
 |
| Q |
119 |
caaaaggataagatgaagaatgatgttgtggttcaagagaatttgaaaattgatgaaaaagattcaaaatttgataatgatcttcctcctattgttttgg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14472646 |
caaaaggataagatgaagaatgatgttgtggttcaagagaatttgaaaattgatgaaaaagattcaaaatttgataatgatcttcctcctattgttttgg |
14472547 |
T |
 |
| Q |
219 |
ttcatggaatttttggatttggcaaaggggtaatgattcatcaatgttgtttctgtctcaaaattaacgtttttgttatgtttatgttgttttgtt |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14472546 |
ttcatggaatttttggatttggcaaaggggtaatgattcatcaatgttgtttctgtctcaaaattaacgtttttgttatgtttatgttgttttgtt |
14472451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University