View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18417_low_37 (Length: 319)
Name: NF18417_low_37
Description: NF18417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18417_low_37 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 18 - 308
Target Start/End: Original strand, 15303348 - 15303641
Alignment:
| Q |
18 |
gtttttgcattgttt-gtttggtcttttaaagcattattttgcattcttacgtgacttttagtggtcttagtaaagtcatgtaatgtctaaga---acat |
113 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
15303348 |
gtttttgcattgttttgtttggtcttttaaagcattattttgcattcttacgtgacttttagtggtcttagtaaagtcatgtaatgtttaagaagaacat |
15303447 |
T |
 |
| Q |
114 |
tgacaatattttggtccaatggcacaataatgggaaatgcaagaatattgcaattcaggttggaatattctacacatctccacttctatggttctttagc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15303448 |
tgacaatattttggtccaatggcacaataatgggaaatgcaagaatattgcaattcaggttggaatattctacacatctccacttctatggttctttagc |
15303547 |
T |
 |
| Q |
214 |
taatgaaccaaccttgtccatcaaaatttccttccaaacatcttcacattattgtacttggatttggatggacatttagtcaacaaattgttcat |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||| |||| ||||||||||| |
|
|
| T |
15303548 |
taatgaaccaaccttgtccatcaaaatttccttccaaacatcttcacattattgtacttgga-ttggattgacatttattcaagaaattgttcat |
15303641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University