View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18417_low_40 (Length: 291)
Name: NF18417_low_40
Description: NF18417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18417_low_40 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 18 - 284
Target Start/End: Original strand, 31137574 - 31137840
Alignment:
| Q |
18 |
atatatgtatacatttaccgagccaaaaagaaattcaaatcaagatggtttcataaatgtgaatttattattttcacgtgatacaagattaccagaattg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31137574 |
atatatgtatacatttaccgagccaaaaagaaattcaaatcaagatggtttcataaatgtgaatttattattttcacgtgatacaagattaccagaattg |
31137673 |
T |
 |
| Q |
118 |
ttttggtcaattagggatggatagtttgtggttcaagaatttctatccatttgatcatttcaaatttcaaatatgtaattaaaaatgtgtacatgcatat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31137674 |
ttttggtcaattagggatggatagtttgtggttcaagaatttctatccatatgatcatttcaaatttcaaatatgtaattaaaaatgtgtacatgcatat |
31137773 |
T |
 |
| Q |
218 |
atgtttttataagatttataagccagatactacaaattcaggaatggatcttcttcgtttcttctct |
284 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31137774 |
atgtttttataagatttataaaccagatactacaaattcaggaatggatcttcttcgtttcttctct |
31137840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University