View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18417_low_43 (Length: 283)
Name: NF18417_low_43
Description: NF18417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18417_low_43 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 133; Significance: 3e-69; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 130 - 270
Target Start/End: Original strand, 42615768 - 42615908
Alignment:
| Q |
130 |
ttattattaattaaagtgatactgacaactattctagatgaaatttgaactcggctgcttgaagttttaatatcaaactcttatcatcgaattaacaccc |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42615768 |
ttattattaattaaagtgatactgacaactattctagatgaaatttgaactcggctgcttgaagttttaatatcaaactcttatcatcgaattaacaccc |
42615867 |
T |
 |
| Q |
230 |
gataaacgaaaacaacacattcaatggttgaaaactaacat |
270 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
42615868 |
gataaacgaaaacaacacattcaatagttgaaaacttacat |
42615908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 17 - 99
Target Start/End: Original strand, 42615655 - 42615737
Alignment:
| Q |
17 |
aatattccttgccaattccttttgtctcttacccacatcatgaccctccccttccaagctccaatcacaggaacaatatattt |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42615655 |
aatattccttgccaattccttttgtctcttacccacatcatgaccctccccttccaagctccaatcacaggaacaatatattt |
42615737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University