View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18418_low_3 (Length: 499)
Name: NF18418_low_3
Description: NF18418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18418_low_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 130; Significance: 4e-67; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 130; E-Value: 4e-67
Query Start/End: Original strand, 256 - 389
Target Start/End: Original strand, 25949158 - 25949291
Alignment:
| Q |
256 |
tcctgcaggcaaagaaactagttgtttcgtcgttttattttagcatgtctgcaactaatatcgtgtctcttctgtaataataatttttccttttgaggtg |
355 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25949158 |
tcctgcaggcatagaaactagttgtttcgtcgttttattttagcatgtctgcaactaatatcgtgtctcttctgtaataataatttttccttttgaggtg |
25949257 |
T |
|
| Q |
356 |
atgattttaatgatgcgggtgtttgaaggaggaa |
389 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
25949258 |
atgattttaatgatgcgggtgtttgaaggaggaa |
25949291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 227 - 380
Target Start/End: Original strand, 25952862 - 25953013
Alignment:
| Q |
227 |
tttggtatgagggcttgaaatttaagatgtcctgcaggcaaagaaactagttgtttcgtcgttttattttagcatgtctgcaactaatatcgtgtctctt |
326 |
Q |
| |
|
|||||| |||||||| | ||||||||||||||||| || | ||||| ||||||||||||||||||||||||| || |||| |||||||||||||||| |
|
|
| T |
25952862 |
tttggtttgagggctaaacatttaagatgtcctgcaagcttataaactggttgtttcgtcgttttattttagcaagtatgcatctaatatcgtgtctct- |
25952960 |
T |
|
| Q |
327 |
ctgtaataataatttttccttttgaggtgatgattttaatgatgcgggtgtttg |
380 |
Q |
| |
|
||| |||||||||||| |||| |||||||| ||||||||||||||||||| |
|
|
| T |
25952961 |
-tgttctaataatttttctttttcccgtgatgatcttaatgatgcgggtgtttg |
25953013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 392 - 459
Target Start/End: Original strand, 25949337 - 25949404
Alignment:
| Q |
392 |
agatgattaaactacttgcagaagtgtgggagcgcttattaccagcaaatggttcatgttctcatgga |
459 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
25949337 |
agatgattaaactacttgcagaagtgtgggagcacttattaccagcaaatggttcatgttctcatgga |
25949404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University