View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18419_low_6 (Length: 247)
Name: NF18419_low_6
Description: NF18419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18419_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 24 - 231
Target Start/End: Complemental strand, 735300 - 735093
Alignment:
| Q |
24 |
atatttaaaagtgaaaacgataaagtcatgaaactctttaaaatgatcataaattaaatgtgtatggttggttatatagtcctagctacatccactctta |
123 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
735300 |
atatttaaaagtgaaaacaataaagtcatgaaactctttaaaatgatcataaattaaatgtgtatggttggttatatagtcctagctacatccactctta |
735201 |
T |
 |
| Q |
124 |
cacacaaataacactctcattagatgcatgagtaggtgagcaaatgaagtaatgaacccttctatgtaaaagtgagttttttgtgctaactagcactctt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
735200 |
cacacaaataacactctcattagatgcatgagtaggtgagcaaatgaagtaatgaacccttctatgtaaaagtgagttttttgtgctatctagcactctt |
735101 |
T |
 |
| Q |
224 |
gtgtgtta |
231 |
Q |
| |
|
|||||||| |
|
|
| T |
735100 |
gtgtgtta |
735093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University