View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1841_high_24 (Length: 300)
Name: NF1841_high_24
Description: NF1841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1841_high_24 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 191; Significance: 1e-104; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 285
Target Start/End: Original strand, 4843697 - 4843983
Alignment:
| Q |
1 |
aaaagttgatattgccaaaaagaatcttgatgtgtaaattgtcatggaaatgtgatgaatattatccnnnnnnngttaaatacttctttgaccaagaccc |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
4843697 |
aaaagttgatattgccaaaaagagtcttgatgtgtaaattgtcatggaaatgtgatgaatattatccaaaaaaagttaaatacttctttgaccaagaccc |
4843796 |
T |
 |
| Q |
101 |
tcnnnnnnnctgtcctttttaggtcgaggtttctttgaatttcaattttcatctgtggaaagaaatgcagcgtgtttgggcttttaggtcgaga--nnnn |
198 |
Q |
| |
|
|| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4843797 |
tctttttttctgtcctttttaggtcgaggtttctttggatttcaattttcatctgtggaaagaaatgcaacgtgtttgggcttttaggtcgagatttttt |
4843896 |
T |
 |
| Q |
199 |
nnnnnatagtttcagcagttttgacaggaagagttgatttctctaatctctaccacaatactgttggacttggaaatatcaaccatt |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4843897 |
tctctatagtttcagcagttttgacaggaagagttgatttctctaatctctaccacaatactgttggacttggaaatttcaaccatt |
4843983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 209 - 243
Target Start/End: Original strand, 4824272 - 4824306
Alignment:
| Q |
209 |
ttcagcagttttgacaggaagagttgatttctcta |
243 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |
|
|
| T |
4824272 |
ttcagcagttttgacaagaagagttgatttctcta |
4824306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 31 - 67
Target Start/End: Original strand, 4813561 - 4813597
Alignment:
| Q |
31 |
tgtgtaaattgtcatggaaatgtgatgaatattatcc |
67 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
4813561 |
tgtgtaaattggcatgggaatgtgatgaatattatcc |
4813597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University