View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1841_high_29 (Length: 249)
Name: NF1841_high_29
Description: NF1841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1841_high_29 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 2 - 239
Target Start/End: Complemental strand, 4843611 - 4843378
Alignment:
| Q |
2 |
ttttatgtgtgaatcaagtatcatccgcatgcaactgcatagactaattcctcgaactgattagcatcataatggatgacaaaannnnnnnnnnnnnnna |
101 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| | |
|
|
| T |
4843611 |
ttttatgtgtgaatcaagtatcatctgcatgcaactgcatagactaatctctcgaactgagtagcatcataatggatgacaaaactctctctctc----a |
4843516 |
T |
 |
| Q |
102 |
agagatttaacattattccattcttaggggtggattggaactcataacctctagttaagctgaaaaagatcctttacgatcccatcaaaataacttctaa |
201 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
4843515 |
agagatttaacattattgcattcttagcggtggattggaactcataacctctagttaagctgaaaaagatcctttacgatctcatccaaataacttctaa |
4843416 |
T |
 |
| Q |
202 |
aatataaacgtataaatggcttgtttggtgatgttcat |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4843415 |
catataaacgtataaatggcttgtttggtgatgttcat |
4843378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University