View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1841_high_30 (Length: 249)
Name: NF1841_high_30
Description: NF1841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1841_high_30 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 4e-90; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 66 - 249
Target Start/End: Complemental strand, 33289695 - 33289512
Alignment:
| Q |
66 |
agcaaacaattgtgattgttttgttgaaaggattacacggatgattttatttgttaaagtaaaagtagctcatttcatccaaactaattataatgagtag |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| ||||||| |||| |
|
|
| T |
33289695 |
agcaaacaattgtgattgttttgttgaaaggattacacggatgattttatttgttgaagtaaaagtagctcatttcatctaaactaaatataatgtgtag |
33289596 |
T |
 |
| Q |
166 |
gggaattaaaattattggagctagactaaaatacaacgttctaattagattatgaacaactctattaacttgcatatgaatgaa |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33289595 |
gggaattaaaattattggagctagactaaaatacaacgttctaattagattatgaacaactctattaacttgcatatgaatgaa |
33289512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 5 - 46
Target Start/End: Complemental strand, 33289754 - 33289713
Alignment:
| Q |
5 |
gagagagatgaagagagcgagcaatttgaacctcaattgtga |
46 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33289754 |
gagaaagatgaagagagtgagcaatttgaacctcaattgtga |
33289713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University