View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1841_low_11 (Length: 394)
Name: NF1841_low_11
Description: NF1841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1841_low_11 |
 |  |
|
| [»] scaffold0009 (1 HSPs) |
 |  |  |
|
| [»] scaffold0132 (2 HSPs) |
 |  |  |
|
| [»] scaffold0016 (1 HSPs) |
 |  |  |
|
| [»] scaffold0045 (1 HSPs) |
 |  |  |
|
| [»] scaffold0442 (1 HSPs) |
 |  |  |
|
| [»] scaffold0018 (1 HSPs) |
 |  |  |
|
| [»] scaffold0774 (1 HSPs) |
 |  |  |
|
| [»] scaffold0300 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 86; Significance: 5e-41; HSPs: 31)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 280 - 381
Target Start/End: Complemental strand, 36359658 - 36359557
Alignment:
| Q |
280 |
catggtgttgatgcaatccagattacgtaatccagacagcaccatcaccaattcttgtgtaaatagagcgtgtgatggctggagctaaggcagctgttgt |
379 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||| |||||||||||||||||||||||| |||||| |
|
|
| T |
36359658 |
catggtgttgatgcaatccagattacgtaatccagacaacaccatcaccaattcttgtgtaaacagagggtgtgatggctggagctaaggcagttgttgt |
36359559 |
T |
 |
| Q |
380 |
tg |
381 |
Q |
| |
|
|| |
|
|
| T |
36359558 |
tg |
36359557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 280 - 381
Target Start/End: Original strand, 34440783 - 34440884
Alignment:
| Q |
280 |
catggtgttgatgcaatccagattacgtaatccagacagcaccatcaccaattcttgtgtaaatagagcgtgtgatggctggagctaaggcagctgttgt |
379 |
Q |
| |
|
||||||| |||||||||| ||||||||||| ||||||| ||| ||||||||||| |||||| |||| || |||||||||||||||||||||||||||| |
|
|
| T |
34440783 |
catggtgctgatgcaatctggattacgtaattcagacagtgccagcaccaattcttatgtaaagagagggtatgatggctggagctaaggcagctgttgt |
34440882 |
T |
 |
| Q |
380 |
tg |
381 |
Q |
| |
|
|| |
|
|
| T |
34440883 |
tg |
34440884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 36 - 86
Target Start/End: Original strand, 38130329 - 38130379
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatga |
86 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
38130329 |
atagaataaaaatttatcttttttacttatattttgggacaaagaaaatga |
38130379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 36 - 87
Target Start/End: Original strand, 12730200 - 12730251
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12730200 |
ataggataaaagtttgtcttttttacttatattttgggacaaagaaaatgag |
12730251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 41 - 85
Target Start/End: Original strand, 11262071 - 11262115
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11262071 |
ataaaagtttgtcttttttacttatattttgggacaaagaaaatg |
11262115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 36 - 87
Target Start/End: Complemental strand, 42273597 - 42273546
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||| |||||| |||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
42273597 |
ataggataaaagtttgtcttttttgcttatattttgggacaaagaaaatgag |
42273546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 41 - 87
Target Start/End: Original strand, 9957634 - 9957680
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
9957634 |
ataaaagtttgtcttttttgcttatattttgggacaaagaaaatgag |
9957680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 41 - 87
Target Start/End: Original strand, 16286281 - 16286327
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
16286281 |
ataaaagtttgtcttttttacttatattttgagacaaagaaaatgag |
16286327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 280 - 334
Target Start/End: Original strand, 38640769 - 38640823
Alignment:
| Q |
280 |
catggtgttgatgcaatccagattacgtaatccagacagcaccatcaccaattct |
334 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||| |||||||||| |||||||||| |
|
|
| T |
38640769 |
catggtgctgatgcaatccggattacgtaatccggacagcaccaacaccaattct |
38640823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 40 - 86
Target Start/End: Original strand, 39505449 - 39505495
Alignment:
| Q |
40 |
aataaaaatttgtcttttttacttatattttgggacaaagaaaatga |
86 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
39505449 |
aataaaagtttgtcttttttgcttatattttgggacaaagaaaatga |
39505495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 41 - 86
Target Start/End: Complemental strand, 8225406 - 8225361
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatga |
86 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
8225406 |
ataaaagtttgtcttttttgcttatattttgggacaaagaaaatga |
8225361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 36 - 85
Target Start/End: Complemental strand, 25840811 - 25840762
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
||||||||||| |||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
25840811 |
atagaataaaagtttgtcatttttgcttatattttgggacaaagaaaatg |
25840762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 36 - 83
Target Start/End: Original strand, 104433 - 104480
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaa |
83 |
Q |
| |
|
|||| |||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
104433 |
ataggataaaagtttgtcttttttacttatattttgggacagagaaaa |
104480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 36 - 87
Target Start/End: Complemental strand, 32433621 - 32433570
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||| ||||||||| ||||| |
|
|
| T |
32433621 |
atagtataaaaatttgtcttttttgcttatattttgagacaaagaatatgag |
32433570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 41 - 87
Target Start/End: Complemental strand, 20643957 - 20643911
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
20643957 |
ataaaagtttgtcttttttgcttatattttgggataaagaaaatgag |
20643911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 41 - 87
Target Start/End: Complemental strand, 34425273 - 34425227
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||||| |||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
34425273 |
ataaaagtttgtcttttttgcttatattttaggacaaagaaaatgag |
34425227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 280 - 334
Target Start/End: Complemental strand, 43388143 - 43388089
Alignment:
| Q |
280 |
catggtgttgatgcaatccagattacgtaatccagacagcaccatcaccaattct |
334 |
Q |
| |
|
||||||| ||||||||||| ||||||||||| ||||||| |||| |||||||||| |
|
|
| T |
43388143 |
catggtgctgatgcaatccggattacgtaattcagacagtaccaacaccaattct |
43388089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 41 - 85
Target Start/End: Original strand, 842753 - 842797
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
|||||| ||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
842753 |
ataaaagtttatcttttttgcttatattttgggacaaagaaaatg |
842797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 41 - 85
Target Start/End: Original strand, 37522777 - 37522821
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
37522777 |
ataaaagtttgtcttttttgcttatattttgggacgaagaaaatg |
37522821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 41 - 85
Target Start/End: Original strand, 37562949 - 37562993
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
37562949 |
ataaaagtttgtcttttttgcttatattttgggacgaagaaaatg |
37562993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 36 - 87
Target Start/End: Original strand, 12793020 - 12793071
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||| |||||| ||||| |||||| |||||||||||| |||||||||||||| |
|
|
| T |
12793020 |
ataggataaaagtttgtattttttgcttatattttggaacaaagaaaatgag |
12793071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 36 - 87
Target Start/End: Original strand, 35462911 - 35462962
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||| |||||| || ||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
35462911 |
atagcataaaagttggtcttttttgcttatattttgagacaaagaaaatgag |
35462962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 280 - 334
Target Start/End: Complemental strand, 8739266 - 8739212
Alignment:
| Q |
280 |
catggtgttgatgcaatccagattacgtaatccagacagcaccatcaccaattct |
334 |
Q |
| |
|
||||||| ||||||||| | |||||||||||||| || |||||| |||||||||| |
|
|
| T |
8739266 |
catggtgctgatgcaattcggattacgtaatccaaactgcaccagcaccaattct |
8739212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 280 - 334
Target Start/End: Original strand, 16429115 - 16429169
Alignment:
| Q |
280 |
catggtgttgatgcaatccagattacgtaatccagacagcaccatcaccaattct |
334 |
Q |
| |
|
||||||| ||||||| | | |||||||||||||| ||||||||| |||||||||| |
|
|
| T |
16429115 |
catggtgctgatgcagttcggattacgtaatccaaacagcaccaacaccaattct |
16429169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 36 - 86
Target Start/End: Original strand, 25962645 - 25962695
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatga |
86 |
Q |
| |
|
|||| |||||| ||||| |||||| ||||||||||| |||||||||||||| |
|
|
| T |
25962645 |
atagcataaaagtttgtattttttgcttatattttgagacaaagaaaatga |
25962695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 36 - 81
Target Start/End: Complemental strand, 38280793 - 38280748
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaa |
81 |
Q |
| |
|
|||| |||||| ||||||||||||| |||||||||| ||||||||| |
|
|
| T |
38280793 |
ataggataaaagtttgtcttttttatttatattttgagacaaagaa |
38280748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 41 - 85
Target Start/End: Complemental strand, 6686357 - 6686313
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
|||||| ||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
6686357 |
ataaaagtttatcttttttgtttatattttgggacaaagaaaatg |
6686313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 36 - 87
Target Start/End: Complemental strand, 17351329 - 17351277
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttata-ttttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||| |||||| |||||||||||| |||| | ||||||||||||||||||||| |
|
|
| T |
17351329 |
ataggataaaagtttgtcttttttgcttacaattttgggacaaagaaaatgag |
17351277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 41 - 81
Target Start/End: Original strand, 30086746 - 30086786
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaa |
81 |
Q |
| |
|
|||||| || ||||||||||||||||||||| ||||||||| |
|
|
| T |
30086746 |
ataaaagttggtcttttttacttatattttgagacaaagaa |
30086786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 31 - 87
Target Start/End: Original strand, 41625720 - 41625776
Alignment:
| Q |
31 |
aatacatagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||| ||||||||||||||| |||||||| ||| |||||| || |||||||||||| |
|
|
| T |
41625720 |
aataaatagaataaaaatttatcttttttgattacattttgagataaagaaaatgag |
41625776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 41 - 85
Target Start/End: Original strand, 43590149 - 43590193
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
|||||| ||||| |||||| |||||||||||| |||||||||||| |
|
|
| T |
43590149 |
ataaaagtttgtattttttgcttatattttggtacaaagaaaatg |
43590193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 86; Significance: 5e-41; HSPs: 40)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 280 - 381
Target Start/End: Original strand, 48304077 - 48304178
Alignment:
| Q |
280 |
catggtgttgatgcaatccagattacgtaatccagacagcaccatcaccaattcttgtgtaaatagagcgtgtgatggctggagctaaggcagctgttgt |
379 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
48304077 |
catggtggtgatgcaatccggattacgtaatccagacagcaccatcaccaattcttgtgtaaacagagggtgtgatggctggagctaaggcagctgttgt |
48304176 |
T |
 |
| Q |
380 |
tg |
381 |
Q |
| |
|
|| |
|
|
| T |
48304177 |
tg |
48304178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 36 - 87
Target Start/End: Original strand, 46557374 - 46557425
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
46557374 |
atagaataaaaatttgtcttttttacttatattttaagacaaagaaaatgag |
46557425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 41 - 120
Target Start/End: Original strand, 11054454 - 11054533
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatgagnnnnnnnncttacattatgggacggagggagta |
120 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||||||||| | |||| |||||||||||||||||||| |
|
|
| T |
11054454 |
ataaaagtttgtcttttttgcttatattttgggacaaagaaaatgtgttttttggcttatattatgggacggagggagta |
11054533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 280 - 334
Target Start/End: Original strand, 8735267 - 8735321
Alignment:
| Q |
280 |
catggtgttgatgcaatccagattacgtaatccagacagcaccatcaccaattct |
334 |
Q |
| |
|
||||||||||||||||||||||||||| ||| | |||||||||| |||||||||| |
|
|
| T |
8735267 |
catggtgttgatgcaatccagattacgaaattcggacagcaccagcaccaattct |
8735321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 280 - 334
Target Start/End: Original strand, 9087508 - 9087562
Alignment:
| Q |
280 |
catggtgttgatgcaatccagattacgtaatccagacagcaccatcaccaattct |
334 |
Q |
| |
|
||||||||||||||||||||||||||| ||| | |||||||||| |||||||||| |
|
|
| T |
9087508 |
catggtgttgatgcaatccagattacgaaattcggacagcaccagcaccaattct |
9087562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 41 - 87
Target Start/End: Original strand, 14752385 - 14752431
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
14752385 |
ataaaagtttgtcttttttgcttatattttgggacaaagaaaatgag |
14752431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 44 - 86
Target Start/End: Original strand, 37042566 - 37042608
Alignment:
| Q |
44 |
aaaatttgtcttttttacttatattttgggacaaagaaaatga |
86 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
37042566 |
aaaatttgtcttttttccttatattttgggacaaagaaaatga |
37042608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 280 - 334
Target Start/End: Complemental strand, 44085494 - 44085440
Alignment:
| Q |
280 |
catggtgttgatgcaatccagattacgtaatccagacagcaccatcaccaattct |
334 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| ||| | |||||||||| |
|
|
| T |
44085494 |
catggtgctgatgcaatccagattacgtaatccagacaacacaagcaccaattct |
44085440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 41 - 85
Target Start/End: Original strand, 23910641 - 23910685
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
23910641 |
ataaaaatttgtcttttttgcttatattttgggacaaaaaaaatg |
23910685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 36 - 87
Target Start/End: Original strand, 7866655 - 7866706
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||| |||||| |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7866655 |
ataggataaaagtttgtcttttttgtttatattttgggacaaagaaaatgag |
7866706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 43 - 125
Target Start/End: Complemental strand, 36546518 - 36546435
Alignment:
| Q |
43 |
aaaaatttgtcttttttacttatattttgggacaaagaaaatgag-nnnnnnnncttacattatgggacggagggagtagttta |
125 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||||||||| | |||| ||||||||||||||||||||||||| |
|
|
| T |
36546518 |
aaaagtttgtcttttttgcttatattttgggacaaagaaaatgtgttttttttgcttatattatgggacggagggagtagttta |
36546435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 43 - 125
Target Start/End: Original strand, 36561797 - 36561880
Alignment:
| Q |
43 |
aaaaatttgtcttttttacttatattttgggacaaagaaaatgag-nnnnnnnncttacattatgggacggagggagtagttta |
125 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||||||||| | |||| ||||||||||||||||||||||||| |
|
|
| T |
36561797 |
aaaagtttgtcttttttgcttatattttgggacaaagaaaatgtgttttttttgcttatattatgggacggagggagtagttta |
36561880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 36 - 86
Target Start/End: Complemental strand, 37074910 - 37074860
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatga |
86 |
Q |
| |
|
|||| |||||| |||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
37074910 |
ataggataaaagtttgtcttttttgcttatatttcgggacaaagaaaatga |
37074860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 36 - 78
Target Start/End: Complemental strand, 50730058 - 50730016
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaa |
78 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
50730058 |
ataggataaaaatttatcttttttacttatattttgggacaaa |
50730016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 36 - 78
Target Start/End: Original strand, 50782794 - 50782836
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaa |
78 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
50782794 |
ataggataaaaatttatcttttttacttatattttgggacaaa |
50782836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 41 - 87
Target Start/End: Original strand, 54465068 - 54465114
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||||||||| |||||||| |||||||||| |||||||||||||||| |
|
|
| T |
54465068 |
ataaaaatttatcttttttgcttatattttaggacaaagaaaatgag |
54465114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 41 - 86
Target Start/End: Original strand, 22479212 - 22479257
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatga |
86 |
Q |
| |
|
|||||| |||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
22479212 |
ataaaagtttgtcttttttgcttataatttgggacaaagaaaatga |
22479257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 36 - 81
Target Start/End: Original strand, 47867087 - 47867132
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaa |
81 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
47867087 |
ataggataaaaatttgtcttttttacttacattttgggataaagaa |
47867132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 36 - 84
Target Start/End: Complemental strand, 6752619 - 6752571
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaat |
84 |
Q |
| |
|
|||| |||||| ||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
6752619 |
ataggataaaagtttgtcttttttacttaaattttaggacaaagaaaat |
6752571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 41 - 85
Target Start/End: Original strand, 23311739 - 23311783
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
|||||| |||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
23311739 |
ataaaagtttgacttttttgcttatattttgggacaaagaaaatg |
23311783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 41 - 85
Target Start/End: Complemental strand, 30189547 - 30189503
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
|||||||||| ||||||||| | |||||||||||||||||||||| |
|
|
| T |
30189547 |
ataaaaatttatcttttttattaatattttgggacaaagaaaatg |
30189503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 51 - 87
Target Start/End: Original strand, 32322409 - 32322445
Alignment:
| Q |
51 |
gtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
32322409 |
gtcttttttacttatattttgagacaaagaaaatgag |
32322445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 43 - 87
Target Start/End: Original strand, 33974738 - 33974782
Alignment:
| Q |
43 |
aaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||| |||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
33974738 |
aaaagtttgtcttttttgcttatattttgagacaaagaaaatgag |
33974782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 48 - 84
Target Start/End: Complemental strand, 47864161 - 47864125
Alignment:
| Q |
48 |
tttgtcttttttacttatattttgggacaaagaaaat |
84 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
47864161 |
tttgtcttttttatttatattttgggacaaagaaaat |
47864125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 36 - 72
Target Start/End: Complemental strand, 51311623 - 51311587
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgg |
72 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |
|
|
| T |
51311623 |
ataggataaaaatttgtcttttttacttatattttgg |
51311587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 40 - 87
Target Start/End: Complemental strand, 2927236 - 2927189
Alignment:
| Q |
40 |
aataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
||||||| |||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
2927236 |
aataaaagtttgtcttttttgcttatattttaagacaaagaaaatgag |
2927189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 48 - 87
Target Start/End: Complemental strand, 6075022 - 6074983
Alignment:
| Q |
48 |
tttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
6075022 |
tttgtcttttttgcttatattttgggacaatgaaaatgag |
6074983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 36 - 87
Target Start/End: Complemental strand, 19464026 - 19463975
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
||||||||||| |||||||||| | |||||||||||||| ||||||||||| |
|
|
| T |
19464026 |
atagaataaaagtttgtcttttctgcttatattttgggatgaagaaaatgag |
19463975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 49 - 84
Target Start/End: Original strand, 29676896 - 29676931
Alignment:
| Q |
49 |
ttgtcttttttacttatattttgggacaaagaaaat |
84 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |
|
|
| T |
29676896 |
ttgtcttttttacttataatttgggacaaagaaaat |
29676931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 41 - 87
Target Start/End: Complemental strand, 1335070 - 1335024
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
||||||||| ||||||||| ||||||||||| ||||||||| ||||| |
|
|
| T |
1335070 |
ataaaaattggtcttttttgcttatattttgagacaaagaatatgag |
1335024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 52 - 86
Target Start/End: Original strand, 20847460 - 20847494
Alignment:
| Q |
52 |
tcttttttacttatattttgggacaaagaaaatga |
86 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
20847460 |
tcttttttacttataatttgggacaaagaaaatga |
20847494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 41 - 87
Target Start/End: Original strand, 41476506 - 41476551
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
41476506 |
ataaaagtttgtctttttta-ttatattttgggacaaacaaaatgag |
41476551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 280 - 334
Target Start/End: Original strand, 45244471 - 45244525
Alignment:
| Q |
280 |
catggtgttgatgcaatccagattacgtaatccagacagcaccatcaccaattct |
334 |
Q |
| |
|
||||||| |||||||||| ||||||||||||| |||||||| | |||||||||| |
|
|
| T |
45244471 |
catggtgctgatgcaatctggattacgtaatccggacagcacgagcaccaattct |
45244525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 280 - 334
Target Start/End: Original strand, 45244680 - 45244734
Alignment:
| Q |
280 |
catggtgttgatgcaatccagattacgtaatccagacagcaccatcaccaattct |
334 |
Q |
| |
|
||||||| | ||||||||| ||||||||||||| |||| ||||||||||||||| |
|
|
| T |
45244680 |
catggtgctaatgcaatccggattacgtaatccggacaataccatcaccaattct |
45244734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 36 - 86
Target Start/End: Complemental strand, 53270183 - 53270133
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatga |
86 |
Q |
| |
|
||||||||||||||| | |||||| |||||||||||| | ||||||||||| |
|
|
| T |
53270183 |
atagaataaaaatttattttttttgcttatattttggaataaagaaaatga |
53270133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 54 - 87
Target Start/End: Complemental strand, 6438013 - 6437980
Alignment:
| Q |
54 |
ttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |
|
|
| T |
6438013 |
ttttttgcttatattttgggacaaagaaaatgag |
6437980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 41 - 86
Target Start/End: Complemental strand, 46580496 - 46580451
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatga |
86 |
Q |
| |
|
|||||| || ||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
46580496 |
ataaaagttggtcttttttacttatattttgagacaaagaatatga |
46580451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 41 - 85
Target Start/End: Original strand, 2994576 - 2994620
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
|||||| |||||| ||||| |||||| |||||||||||||||||| |
|
|
| T |
2994576 |
ataaaagtttgtcattttttcttataatttgggacaaagaaaatg |
2994620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 36 - 84
Target Start/End: Original strand, 16739310 - 16739358
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaat |
84 |
Q |
| |
|
|||| |||||| || ||||||||| ||||||||||| |||||||||||| |
|
|
| T |
16739310 |
atagcataaaagttggtcttttttgcttatattttgagacaaagaaaat |
16739358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 52 - 84
Target Start/End: Complemental strand, 51255137 - 51255105
Alignment:
| Q |
52 |
tcttttttacttatattttgggacaaagaaaat |
84 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
51255137 |
tcttttttacttatattttgagacaaagaaaat |
51255105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 71; Significance: 5e-32; HSPs: 35)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 280 - 378
Target Start/End: Complemental strand, 50392507 - 50392409
Alignment:
| Q |
280 |
catggtgttgatgcaatccagattacgtaatccagacagcaccatcaccaattcttgtgtaaatagagcgtgtgatggctggagctaaggcagctgttg |
378 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| ||||||||||||| || ||||| |
|
|
| T |
50392507 |
catggtgctgatgcaatccggattacgtaatccagacagcaccatcaccaattcttgtgtaaacagagggtgtgattgctggagctaaggtagttgttg |
50392409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 16605006 - 16605092
Alignment:
| Q |
1 |
cttggaaaagagattttttnnnnnnncaataatacatagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
||||||||||||||||||| ||||| || |||| |||||| |||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
16605006 |
cttggaaaagagattttttaaaaaaacaatattaaatagcataaaagtttgtcttttttgcttatattttgggacaaagaaaatgag |
16605092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 36 - 87
Target Start/End: Complemental strand, 39078103 - 39078052
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39078103 |
ataggataaaagtttgtcttttttacttatattttgggacaaagaaaatgag |
39078052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 36 - 85
Target Start/End: Complemental strand, 35529617 - 35529568
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
35529617 |
atagaataaaagtttgtcttttttgcttatattttgggacaaagaaaatg |
35529568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 41 - 85
Target Start/End: Original strand, 41414789 - 41414833
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41414789 |
ataaaagtttgtcttttttacttatattttgggacaaagaaaatg |
41414833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 36 - 87
Target Start/End: Original strand, 17186988 - 17187039
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||| |||||| |||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
17186988 |
ataggataaaagtttgtcttttttgcttatattttgggacaaagaaaatgag |
17187039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 36 - 87
Target Start/End: Original strand, 48793832 - 48793883
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
||||||||||| |||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
48793832 |
atagaataaaagtttgtcttttatgcttatattttgggacaaagaaaatgag |
48793883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 331 - 381
Target Start/End: Original strand, 46846235 - 46846285
Alignment:
| Q |
331 |
ttcttgtgtaaatagagcgtgtgatggctggagctaaggcagctgttgttg |
381 |
Q |
| |
|
|||||||| ||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
46846235 |
ttcttgtgcaaacagagggtgtgatggctggagctaaggcagctgttgttg |
46846285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 42 - 87
Target Start/End: Complemental strand, 55580607 - 55580562
Alignment:
| Q |
42 |
taaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
55580607 |
taaaagtttgtcttttttgcttatattttgggacaaagaaaatgag |
55580562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 41 - 85
Target Start/End: Complemental strand, 2229219 - 2229175
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2229219 |
ataaaagtttgtcttttttgcttatattttgggacaaagaaaatg |
2229175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 41 - 85
Target Start/End: Complemental strand, 14332731 - 14332687
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
14332731 |
ataaaagtttgtcttttttgcttatattttgggacaaagaaaatg |
14332687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 41 - 85
Target Start/End: Original strand, 28669180 - 28669224
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
28669180 |
ataaaaatttgtcctttttgcttatattttgggacaaagaaaatg |
28669224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 40 - 84
Target Start/End: Complemental strand, 42915471 - 42915427
Alignment:
| Q |
40 |
aataaaaatttgtcttttttacttatattttgggacaaagaaaat |
84 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42915471 |
aataaaagtttgtcttttttgcttatattttgggacaaagaaaat |
42915427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 36 - 87
Target Start/End: Original strand, 5222457 - 5222508
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||| |||||| || |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
5222457 |
atagtataaaagttggtcttttttacttatattttaggacaaagaaaatgag |
5222508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 36 - 87
Target Start/End: Original strand, 32012486 - 32012537
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||| |||||| |||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
32012486 |
atagcataaaagtttgtcttttttgcttatattttgagacaaagaaaatgag |
32012537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 36 - 87
Target Start/End: Complemental strand, 52713024 - 52712973
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
52713024 |
atagcataaaaattggtcttttttacttatattttgagacaaagaatatgag |
52712973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 41 - 87
Target Start/End: Original strand, 8013281 - 8013327
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||||| || |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
8013281 |
ataaaagttggtcttttttacttataatttgggacaaagaaaatgag |
8013327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 41 - 87
Target Start/End: Complemental strand, 37911844 - 37911798
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||||| || |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37911844 |
ataaaatttagtcttttttacttataatttgggacaaagaaaatgag |
37911798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 36 - 85
Target Start/End: Original strand, 30012112 - 30012161
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
||||||||||| || |||||||| ||||||||||||||||||||||||| |
|
|
| T |
30012112 |
atagaataaaagttgatcttttttgcttatattttgggacaaagaaaatg |
30012161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 36 - 80
Target Start/End: Original strand, 21181122 - 21181166
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaaga |
80 |
Q |
| |
|
|||| |||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
21181122 |
ataggataaaaatttgtcttttttatttataatttgggacaaaga |
21181166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 41 - 85
Target Start/End: Complemental strand, 47867851 - 47867807
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
|||||| ||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
47867851 |
ataaaagtttttcttttttgcttatattttgggacaaagaaaatg |
47867807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 36 - 87
Target Start/End: Complemental strand, 4058660 - 4058609
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||| |||||| |||||||||||| |||||||||| ||||||||||| |||| |
|
|
| T |
4058660 |
ataggataaaagtttgtcttttttgcttatattttaggacaaagaaagtgag |
4058609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 36 - 87
Target Start/End: Original strand, 12002841 - 12002892
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
||||||||||| |||||||||||| |||| |||| |||||||||||| |||| |
|
|
| T |
12002841 |
atagaataaaagtttgtcttttttgcttacatttagggacaaagaaagtgag |
12002892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 40 - 87
Target Start/End: Original strand, 35310953 - 35311000
Alignment:
| Q |
40 |
aataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
||||||| |||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
35310953 |
aataaaagtttgtcttttttgcttatattttaagacaaagaaaatgag |
35311000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 36 - 87
Target Start/End: Original strand, 39970148 - 39970199
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||| ||||||||| ||||||||| ||||||||||| ||||||||| ||||| |
|
|
| T |
39970148 |
atagcataaaaattagtcttttttgcttatattttgagacaaagaatatgag |
39970199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 36 - 87
Target Start/End: Complemental strand, 50768406 - 50768355
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||| |||||| || ||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
50768406 |
atagcataaaagttggtcttttttgcttatattttgagacaaagaaaatgag |
50768355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 41 - 86
Target Start/End: Original strand, 5483489 - 5483535
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggac-aaagaaaatga |
86 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||| ||||||||||| |
|
|
| T |
5483489 |
ataaaaatttgtcttttttacttacattttgagacaaaagaaaatga |
5483535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 41 - 87
Target Start/End: Original strand, 29180576 - 29180622
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||||| |||||||||||| ||||||||||| ||||||||| ||||| |
|
|
| T |
29180576 |
ataaaagtttgtcttttttgcttatattttgagacaaagaatatgag |
29180622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 44 - 82
Target Start/End: Original strand, 29581590 - 29581628
Alignment:
| Q |
44 |
aaaatttgtcttttttacttatattttgggacaaagaaa |
82 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
29581590 |
aaaatttgtcttttttatttataatttgggacaaagaaa |
29581628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 36 - 86
Target Start/End: Complemental strand, 37788412 - 37788362
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatga |
86 |
Q |
| |
|
|||| |||||| || ||||||||||||||||||||| || ||||||||||| |
|
|
| T |
37788412 |
atagcataaaagttggtcttttttacttatattttgagataaagaaaatga |
37788362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 41 - 87
Target Start/End: Complemental strand, 53848427 - 53848381
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||||| || |||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
53848427 |
ataaaagttggtcttttttacttataatttgggacaaagaagatgag |
53848381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 36 - 81
Target Start/End: Complemental strand, 19351785 - 19351740
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaa |
81 |
Q |
| |
|
||||||||||| |||||||||||| |||| ||||||||| |||||| |
|
|
| T |
19351785 |
atagaataaaagtttgtctttttttcttacattttgggataaagaa |
19351740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 40 - 85
Target Start/End: Original strand, 47516382 - 47516427
Alignment:
| Q |
40 |
aataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
||||||| || ||||||||| |||||| |||||||||||||||||| |
|
|
| T |
47516382 |
aataaaagttggtcttttttgcttataatttgggacaaagaaaatg |
47516427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 41 - 85
Target Start/End: Complemental strand, 7654599 - 7654555
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
|||||| |||||||||||| |||||||||| ||| |||||||||| |
|
|
| T |
7654599 |
ataaaagtttgtcttttttgcttatattttaggataaagaaaatg |
7654555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 41 - 85
Target Start/End: Complemental strand, 26916297 - 26916253
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
|||||| ||| |||||||| ||||||||||| ||||||||||||| |
|
|
| T |
26916297 |
ataaaagtttatcttttttgcttatattttgagacaaagaaaatg |
26916253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 59; Significance: 7e-25; HSPs: 38)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 280 - 381
Target Start/End: Original strand, 38950355 - 38950450
Alignment:
| Q |
280 |
catggtgttgatgcaatccagattacgtaatccagacagcaccatcaccaattcttgtgtaaatagagcgtgtgatggctggagctaaggcagctgttgt |
379 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||||| |||||| ||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
38950355 |
catggtgttgatgcaattcggattacgtaatccagacagcagcatcac------ttgtgtaaacagagggtgtgatggctggagctaaggcagctgttgt |
38950448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 36 - 87
Target Start/End: Original strand, 44149045 - 44149096
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
44149045 |
atagaataaaagtttgtcttttttgcttatattttgggacaaagaaaatgag |
44149096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 41 - 87
Target Start/End: Original strand, 15959858 - 15959904
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
15959858 |
ataaaaatttgtcttttttgcttatattttgggacaaagaaaatgag |
15959904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 280 - 334
Target Start/End: Complemental strand, 43319269 - 43319215
Alignment:
| Q |
280 |
catggtgttgatgcaatccagattacgtaatccagacagcaccatcaccaattct |
334 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43319269 |
catggtgctgatgcaatccggattacgtaatccggacagcaccatcaccaattct |
43319215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 28016922 - 28017008
Alignment:
| Q |
1 |
cttggaaaagagattttttnnnnnnncaataatacatagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
||||||||||||||||||| ||| | || |||| |||||| |||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
28016922 |
cttggaaaagagatttttttaaaaaacaagattaaataggataaaagtttgtcttttttgcttatattttgggacaaagaaaatgag |
28017008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 2 - 87
Target Start/End: Complemental strand, 4672881 - 4672796
Alignment:
| Q |
2 |
ttggaaaagagattttttnnnnnnncaataatacatagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||||||||||||||||| ||| | || |||| |||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4672881 |
ttggaaaagagatttttttaaaaaacaagattaaataggataaaaatttatcttttttgcttatattttgggacaaagaaaatgag |
4672796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 36 - 87
Target Start/End: Original strand, 7468166 - 7468217
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||| |||||| |||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
7468166 |
ataggataaaagtttgtcttttttgcttatattttgggacaaagaaaatgag |
7468217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 36 - 87
Target Start/End: Original strand, 47600253 - 47600304
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||| |||||||||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
47600253 |
ataggataaaaatttgtcttttttacttatactttcggacaaagaaaatgag |
47600304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 41 - 87
Target Start/End: Complemental strand, 6786780 - 6786734
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
6786780 |
ataaaagtttgtcttttttgcttatattttgggacaaagaaaatgag |
6786734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 41 - 85
Target Start/End: Complemental strand, 2126011 - 2125967
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2126011 |
ataaaagtttgtcttttttacttatattttaggacaaagaaaatg |
2125967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 27 - 87
Target Start/End: Original strand, 6787195 - 6787255
Alignment:
| Q |
27 |
caataatacatagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
||||| || |||| |||||| |||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
6787195 |
caatattaaataggataaaagtttgtcttttttgcttatattttgggataaagaaaatgag |
6787255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 41 - 85
Target Start/End: Original strand, 12449154 - 12449198
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
12449154 |
ataaaagtttgtcttttttgcttatattttgggacaaagaaaatg |
12449198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 41 - 85
Target Start/End: Original strand, 32624193 - 32624237
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32624193 |
ataaaagtttgtcttttttgcttatattttgggacaaagaaaatg |
32624237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 41 - 85
Target Start/End: Original strand, 39555773 - 39555817
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39555773 |
ataaaagtttgtcttttttgcttatattttgggacaaagaaaatg |
39555817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 36 - 87
Target Start/End: Complemental strand, 1820363 - 1820312
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||| |||||| ||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
1820363 |
ataggataaaagtttgtcttttttacttatattttaggataaagaaaatgag |
1820312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 36 - 87
Target Start/End: Original strand, 26907285 - 26907336
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||| |||||| || ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
26907285 |
atagcataaaagttggtcttttttacttatattttgagacaaagaaaatgag |
26907336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 43 - 86
Target Start/End: Complemental strand, 33431501 - 33431458
Alignment:
| Q |
43 |
aaaaatttgtcttttttacttatattttgggacaaagaaaatga |
86 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33431501 |
aaaattttgtcttttttacttatattttggaacaaagaaaatga |
33431458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 36 - 86
Target Start/End: Complemental strand, 47026442 - 47026392
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatga |
86 |
Q |
| |
|
|||| |||||| ||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
47026442 |
ataggataaaagtttgtcttttttacttatattttagaacaaagaaaatga |
47026392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 6785439 - 6785353
Alignment:
| Q |
1 |
cttggaaaagagattttttnnnnnnncaataatacatagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
||||||||||||||||||| ||| | || |||| |||||| ||| |||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
6785439 |
cttggaaaagagattttttttaaaaacaagattaaataggataaaagtttatcttttttgcttatattttgtgacaaagaaaatgag |
6785353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 40 - 85
Target Start/End: Original strand, 42965999 - 42966044
Alignment:
| Q |
40 |
aataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
42965999 |
aataaaagtttgtcttttttacttgtattttgggacaaataaaatg |
42966044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 41 - 85
Target Start/End: Complemental strand, 35691365 - 35691321
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
|||||||||| | ||||||||||||||||||| |||||||||||| |
|
|
| T |
35691365 |
ataaaaatttattttttttacttatattttggtacaaagaaaatg |
35691321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 41 - 85
Target Start/End: Original strand, 43667487 - 43667531
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
|||||| |||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
43667487 |
ataaaagtttgtcttttttgcttatattttgagacaaagaaaatg |
43667531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 36 - 87
Target Start/End: Original strand, 298880 - 298931
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||| |||||| |||||||||||| |||| |||||| ||||||||||||||| |
|
|
| T |
298880 |
ataggataaaactttgtcttttttgcttacattttgagacaaagaaaatgag |
298931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 36 - 87
Target Start/End: Original strand, 24728840 - 24728891
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
||||||||||||||| | | |||| ||||||||||| ||||||||||||||| |
|
|
| T |
24728840 |
atagaataaaaatttatttatttttcttatattttgagacaaagaaaatgag |
24728891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 36 - 87
Target Start/End: Complemental strand, 25990712 - 25990661
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||| ||||||||| ||||||||| ||||||||||| ||||||||| ||||| |
|
|
| T |
25990712 |
atagcataaaaattggtcttttttgcttatattttgagacaaagaatatgag |
25990661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 36 - 87
Target Start/End: Original strand, 28916711 - 28916762
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||| |||||| || ||||| |
|
|
| T |
28916711 |
atagcataaaagtttgtcttttttacttatattttgagacaaaaaatatgag |
28916762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 36 - 87
Target Start/End: Complemental strand, 29488712 - 29488661
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||| |||||| || ||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
29488712 |
atagcataaaagttggtcttttttgcttatattttgagacaaagaaaatgag |
29488661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 36 - 87
Target Start/End: Complemental strand, 40220021 - 40219970
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||| ||||||||| ||||||||| ||||||||||| ||||||||| ||||| |
|
|
| T |
40220021 |
atagcataaaaattagtcttttttgcttatattttgagacaaagaatatgag |
40219970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 41 - 87
Target Start/End: Complemental strand, 5950401 - 5950355
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
||||||||||||||||||| ||| || | |||||||||||||||||| |
|
|
| T |
5950401 |
ataaaaatttgtcttttttgcttgtaatctgggacaaagaaaatgag |
5950355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 41 - 87
Target Start/End: Complemental strand, 15285763 - 15285717
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
||||||||| ||||||||| ||||||||||| ||||||||| ||||| |
|
|
| T |
15285763 |
ataaaaattggtcttttttgcttatattttgagacaaagaatatgag |
15285717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 280 - 334
Target Start/End: Complemental strand, 43319058 - 43319004
Alignment:
| Q |
280 |
catggtgttgatgcaatccagattacgtaatccagacagcaccatcaccaattct |
334 |
Q |
| |
|
||||||| ||||||||||| |||||||||||| |||| ||||| |||||||||| |
|
|
| T |
43319058 |
catggtgctgatgcaatccggattacgtaatctggacaacaccagcaccaattct |
43319004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 86
Target Start/End: Original strand, 51339096 - 51339142
Alignment:
| Q |
40 |
aataaaaatttgtcttttttacttatattttgggacaaagaaaatga |
86 |
Q |
| |
|
||||||| || |||||||||||||||| |||| |||||||||||||| |
|
|
| T |
51339096 |
aataaaagttagtcttttttacttataatttgcgacaaagaaaatga |
51339142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 54 - 87
Target Start/End: Complemental strand, 16854065 - 16854032
Alignment:
| Q |
54 |
ttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |
|
|
| T |
16854065 |
ttttttgcttatattttgggacaaagaaaatgag |
16854032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 41 - 74
Target Start/End: Original strand, 32983357 - 32983390
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttggga |
74 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
32983357 |
ataaaaatttgtcttttttgcttatattttggga |
32983390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 54 - 87
Target Start/End: Complemental strand, 46542911 - 46542878
Alignment:
| Q |
54 |
ttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |
|
|
| T |
46542911 |
ttttttgcttatattttgggacaaagaaaatgag |
46542878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 169 - 209
Target Start/End: Original strand, 1800965 - 1801005
Alignment:
| Q |
169 |
cagggccgtctcaaacaattcgttggcacgattttaatctt |
209 |
Q |
| |
|
||||||||||| ||||||||||||||| | ||||||||||| |
|
|
| T |
1800965 |
cagggccgtcttaaacaattcgttggccccattttaatctt |
1801005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 36 - 76
Target Start/End: Original strand, 3875236 - 3875276
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggaca |
76 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
3875236 |
ataggataaaaatttgtcttttttgcttatattatgggaca |
3875276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 41 - 85
Target Start/End: Complemental strand, 24190444 - 24190401
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
24190444 |
ataaaagtttgtctttttt-cttatattttggtacaaagaaaatg |
24190401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 49; Significance: 6e-19; HSPs: 32)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 27 - 87
Target Start/End: Original strand, 29524244 - 29524304
Alignment:
| Q |
27 |
caataatacatagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
||||| || ||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29524244 |
caatattaaatagaataaaagtttgtcttttttacttatattttgggacaaagaaaatgag |
29524304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 36 - 84
Target Start/End: Original strand, 40808925 - 40808973
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaat |
84 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40808925 |
atagaataaaaatttgtcttttttgcttatattttgggacaaagaaaat |
40808973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 36 - 84
Target Start/End: Original strand, 5280693 - 5280741
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaat |
84 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5280693 |
ataggataaaaatttgtcttttttgcttatattttgggacaaagaaaat |
5280741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 36 - 87
Target Start/End: Complemental strand, 25571992 - 25571941
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
||||||||||| ||||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
25571992 |
atagaataaaagtttgttttttttgcttatattttgggacaaagaaaatgag |
25571941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 36 - 87
Target Start/End: Original strand, 33198847 - 33198898
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||| |||||| |||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
33198847 |
ataggataaaattttgtcttttttgcttatattttgggacaaagaaaatgag |
33198898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 41 - 87
Target Start/End: Complemental strand, 19264042 - 19263996
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
19264042 |
ataaaagtttgtcttttttgcttatattttgggacaaagaaaatgag |
19263996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 41 - 85
Target Start/End: Original strand, 6110387 - 6110431
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6110387 |
ataaaagtttgtcttttttgcttatattttgggacaaagaaaatg |
6110431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 40 - 87
Target Start/End: Complemental strand, 18455009 - 18454962
Alignment:
| Q |
40 |
aataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
||||||||||| |||||||| |||||||||| |||||||||||||||| |
|
|
| T |
18455009 |
aataaaaatttatcttttttgcttatattttaggacaaagaaaatgag |
18454962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 36 - 87
Target Start/End: Complemental strand, 45660310 - 45660259
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||| |||||| ||||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
45660310 |
ataggataaaagtttgttttttttgcttatattttgggacaaagaaaatgag |
45660259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 280 - 334
Target Start/End: Original strand, 25715446 - 25715500
Alignment:
| Q |
280 |
catggtgttgatgcaatccagattacgtaatccagacagcaccatcaccaattct |
334 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||| |||| ||||| |||||||||| |
|
|
| T |
25715446 |
catggtgctgatgcaatccggattacgtaatccggacaacaccaacaccaattct |
25715500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 41 - 87
Target Start/End: Complemental strand, 38070958 - 38070912
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||||| |||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
38070958 |
ataaaagtttgtcttttttgcttataatttgggacaaagaaaatgag |
38070912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 54 - 87
Target Start/End: Original strand, 13822970 - 13823003
Alignment:
| Q |
54 |
ttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
13822970 |
ttttttacttatattttgggacaaagaaaatgag |
13823003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 36 - 85
Target Start/End: Original strand, 18834104 - 18834153
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
||||||||||| || |||||||| ||||||||||||||||||||||||| |
|
|
| T |
18834104 |
atagaataaaagttgatcttttttgcttatattttgggacaaagaaaatg |
18834153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 41 - 85
Target Start/End: Original strand, 28599335 - 28599379
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28599335 |
ataaaagtttgtcttttttgattatattttgggacaaagaaaatg |
28599379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 41 - 85
Target Start/End: Complemental strand, 41528230 - 41528186
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
41528230 |
ataaaagtttgtcttttttgcttatattttgggacaaacaaaatg |
41528186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 36 - 87
Target Start/End: Complemental strand, 8784359 - 8784308
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||| |||||| || ||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
8784359 |
atagcataaaagttggtcttttttacttatattttgagacaaagaatatgag |
8784308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 41 - 87
Target Start/End: Complemental strand, 14873904 - 14873857
Alignment:
| Q |
41 |
ataaaaatttgtctttttta-cttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
14873904 |
ataaaaatttgtttttttttgcttatattttgggacaaagaaaatgag |
14873857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 36 - 87
Target Start/End: Complemental strand, 28858257 - 28858206
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||| |||||| ||||| |||||| |||||||||| |||||||||||||||| |
|
|
| T |
28858257 |
ataggataaaagtttgtattttttgcttatattttaggacaaagaaaatgag |
28858206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 36 - 87
Target Start/End: Complemental strand, 33635300 - 33635249
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||| |||||| || ||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
33635300 |
atagcataaaagttggtcttttttgcttatattttgagacaaagaaaatgag |
33635249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 41 - 84
Target Start/End: Complemental strand, 45085231 - 45085188
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaat |
84 |
Q |
| |
|
|||||| ||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
45085231 |
ataaaagtttatcttttttgcttatattttgggacaaagaaaat |
45085188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 86
Target Start/End: Original strand, 6766149 - 6766195
Alignment:
| Q |
40 |
aataaaaatttgtcttttttacttatattttgggacaaagaaaatga |
86 |
Q |
| |
|
||||||||||| ||||||||||||| ||| ||| ||||||||||||| |
|
|
| T |
6766149 |
aataaaaatttatcttttttacttacattctggaacaaagaaaatga |
6766195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 280 - 334
Target Start/End: Complemental strand, 9847493 - 9847439
Alignment:
| Q |
280 |
catggtgttgatgcaatccagattacgtaatccagacagcaccatcaccaattct |
334 |
Q |
| |
|
||||||| |||||||||| |||||||||||| |||||||||| |||||||||| |
|
|
| T |
9847493 |
catggtgctgatgcaatctggattacgtaatctggacagcaccaacaccaattct |
9847439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 36 - 82
Target Start/End: Complemental strand, 11616971 - 11616925
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaa |
82 |
Q |
| |
|
|||| |||||| ||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
11616971 |
ataggataaaagtttatcttttttacttatattttaggacaaagaaa |
11616925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 36 - 86
Target Start/End: Original strand, 15858802 - 15858852
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatga |
86 |
Q |
| |
|
|||| |||||| || ||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
15858802 |
atagcataaaatttggtcttttttacttatattttgagacaaagaatatga |
15858852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 41 - 87
Target Start/End: Complemental strand, 21539716 - 21539670
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||||| || ||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
21539716 |
ataaaagttggtcttttttgcttatattttgagacaaagaaaatgag |
21539670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 41 - 87
Target Start/End: Complemental strand, 43451475 - 43451429
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
43451475 |
ataaaaattgatcttttttacttatattttgatacaaagaaaatgag |
43451429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 48 - 85
Target Start/End: Complemental strand, 3201302 - 3201265
Alignment:
| Q |
48 |
tttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
3201302 |
tttgtcttttttgcttatattttgggataaagaaaatg |
3201265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 281 - 334
Target Start/End: Complemental strand, 9847284 - 9847231
Alignment:
| Q |
281 |
atggtgttgatgcaatccagattacgtaatccagacagcaccatcaccaattct |
334 |
Q |
| |
|
|||||| ||||||||||| |||||||||||| |||| ||||| |||||||||| |
|
|
| T |
9847284 |
atggtgctgatgcaatccggattacgtaatctggacaacaccaacaccaattct |
9847231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 41 - 86
Target Start/End: Complemental strand, 15068705 - 15068660
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatga |
86 |
Q |
| |
|
||||||||| |||||||| ||||||||||| |||||||||||||| |
|
|
| T |
15068705 |
ataaaaattgatcttttttgcttatattttgagacaaagaaaatga |
15068660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 36 - 81
Target Start/End: Complemental strand, 35832376 - 35832331
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaa |
81 |
Q |
| |
|
|||| |||||||| |||||||||| ||||||||||| ||||||||| |
|
|
| T |
35832376 |
atagcataaaaatatgtcttttttgcttatattttgagacaaagaa |
35832331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 36 - 84
Target Start/End: Original strand, 4033867 - 4033915
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaat |
84 |
Q |
| |
|
|||| ||||||||| |||||||| ||||||||||| |||||||||||| |
|
|
| T |
4033867 |
atagcataaaaattgatcttttttgcttatattttgagacaaagaaaat |
4033915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 41 - 85
Target Start/End: Complemental strand, 35517096 - 35517052
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| || ||||||||| |
|
|
| T |
35517096 |
ataaaagtttgtcttttttgcttatattttggtacgaagaaaatg |
35517052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 48; Significance: 2e-18; HSPs: 33)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 36 - 87
Target Start/End: Complemental strand, 47778720 - 47778669
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
47778720 |
atagaataaaaatttgtcttttttgcttatattttgggacaaagaaaatgag |
47778669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 41 - 85
Target Start/End: Complemental strand, 16562722 - 16562678
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16562722 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
16562678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 41 - 85
Target Start/End: Original strand, 16602940 - 16602984
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16602940 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
16602984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 40 - 84
Target Start/End: Original strand, 46760443 - 46760487
Alignment:
| Q |
40 |
aataaaaatttgtcttttttacttatattttgggacaaagaaaat |
84 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46760443 |
aataaaagtttgtcttttttacttatattttgggacaaagaaaat |
46760487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 36 - 87
Target Start/End: Complemental strand, 36576381 - 36576330
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
36576381 |
atagcataaaagtttgtcttttttacttatattttgagacaaagaaaatgag |
36576330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 41 - 120
Target Start/End: Original strand, 47557933 - 47558012
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatgagnnnnnnnncttacattatgggacggagggagta |
120 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||||||||| | |||| |||||||||||||||||||| |
|
|
| T |
47557933 |
ataaaagtttgtcttttttgcttatattttgggacaaagaaaatgtgttttttttcttatattatgggacggagggagta |
47558012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 41 - 87
Target Start/End: Complemental strand, 30082322 - 30082276
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
30082322 |
ataaaaattggtcttttttgcttatattttgggacaaagaaaatgag |
30082276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 41 - 86
Target Start/End: Complemental strand, 25944519 - 25944474
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatga |
86 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
25944519 |
ataaaagtttgtcttttttgcttatattttgggacaaagaaaatga |
25944474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 41 - 85
Target Start/End: Complemental strand, 18102503 - 18102459
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
18102503 |
ataaaagtttgtcttttttgcttatattttgggacaaagaaaatg |
18102459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 36 - 87
Target Start/End: Complemental strand, 15995662 - 15995611
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||||||||| ||| |||| |
|
|
| T |
15995662 |
atagaataaaaatttgtctttttttcttatatattgggacaaacaaagtgag |
15995611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 41 - 120
Target Start/End: Original strand, 19912955 - 19913034
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatgagnnnnnnnncttacattatgggacggagggagta |
120 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||| |||||||||| | |||| |||||||||||||||||||| |
|
|
| T |
19912955 |
ataaaagtttgtcttttttatttatattttgggataaagaaaatgtgttattttgcttatattatgggacggagggagta |
19913034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 41 - 84
Target Start/End: Complemental strand, 39174224 - 39174181
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaat |
84 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
39174224 |
ataaaagtttgtcttttttacttatattttggaacaaagaaaat |
39174181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 84
Target Start/End: Complemental strand, 9158073 - 9157990
Alignment:
| Q |
1 |
cttggaaaagagattttttnnnnnnncaataatacatagaataaaaatttgtcttttttacttatattttgggacaaagaaaat |
84 |
Q |
| |
|
||||||||||||||||||| ||| | || ||||||||||| |||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
9158073 |
cttggaaaagagattttttttaaaaacaagattaaatagaataaaagtttgtcttttttgattatattttgggataaagaaaat |
9157990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 41 - 87
Target Start/End: Original strand, 18800919 - 18800965
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||||| | |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
18800919 |
ataaaagtatgtcttttttgcttatattttgggacaaagaaaatgag |
18800965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 40 - 86
Target Start/End: Original strand, 28843655 - 28843701
Alignment:
| Q |
40 |
aataaaaatttgtcttttttacttatattttgggacaaagaaaatga |
86 |
Q |
| |
|
||||||||||| || |||||||||||||||||||| ||||||||||| |
|
|
| T |
28843655 |
aataaaaatttatcctttttacttatattttgggataaagaaaatga |
28843701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 36 - 85
Target Start/End: Original strand, 35069047 - 35069096
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
|||| |||||| |||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
35069047 |
ataggataaaagtttgtcatttttacttatattttgggacaaaaaaaatg |
35069096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 41 - 85
Target Start/End: Complemental strand, 14805844 - 14805800
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
|||||| ||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
14805844 |
ataaaagtttgtctgttttgcttatattttgggacaaagaaaatg |
14805800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 41 - 85
Target Start/End: Complemental strand, 15252838 - 15252794
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
|||||| ||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
15252838 |
ataaaagtttgtctgttttgcttatattttgggacaaagaaaatg |
15252794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 43 - 87
Target Start/End: Original strand, 21761939 - 21761983
Alignment:
| Q |
43 |
aaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||| |||||||| |
|
|
| T |
21761939 |
aaaaatttgtcttttttacttataatttgagacaaaaaaaatgag |
21761983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 43 - 87
Target Start/End: Complemental strand, 38260275 - 38260231
Alignment:
| Q |
43 |
aaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||| ||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
38260275 |
aaaagtttgtattttttacttataatttgggacaaagaaaatgag |
38260231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 41 - 85
Target Start/End: Complemental strand, 45485927 - 45485883
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
|||||| |||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
45485927 |
ataaaattttgtcttttttgcttatatttttggacaaagaaaatg |
45485883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 1 - 85
Target Start/End: Original strand, 4910810 - 4910894
Alignment:
| Q |
1 |
cttggaaaagagattttttnnnnnnncaataatacatagaataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
||||||||||||||||||| ||| | || ||| ||||||| ||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
4910810 |
cttggaaaagagattttttgaaaaaacaagattaaatataataaaagtttgttctttttgcttatattttgggacaaagaaaatg |
4910894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 36 - 87
Target Start/End: Complemental strand, 22632035 - 22631984
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
||||||||||| |||||| ||||| |||||||||| | |||||||||||||| |
|
|
| T |
22632035 |
atagaataaaagtttgtcctttttgcttatattttagaacaaagaaaatgag |
22631984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 36 - 82
Target Start/End: Original strand, 31280611 - 31280658
Alignment:
| Q |
36 |
atagaataaaaatttgtctttt-ttacttatattttgggacaaagaaa |
82 |
Q |
| |
|
|||| |||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
31280611 |
ataggataaaaatttgtatttttttacttatattttgggacaaagaaa |
31280658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 48 - 87
Target Start/End: Original strand, 31550103 - 31550142
Alignment:
| Q |
48 |
tttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
31550103 |
tttgtcttttttacttacattttgggacaaagaaattgag |
31550142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 36 - 87
Target Start/End: Original strand, 41890411 - 41890462
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||| ||||||||| ||||||||| ||||||||||| ||||||||| ||||| |
|
|
| T |
41890411 |
atagcataaaaattggtcttttttgcttatattttgagacaaagaatatgag |
41890462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 36 - 87
Target Start/End: Complemental strand, 45598867 - 45598816
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||| ||||||||| ||||||||| ||||||||||| ||||||||| ||||| |
|
|
| T |
45598867 |
atagcataaaaattagtcttttttgcttatattttgagacaaagaacatgag |
45598816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 37 - 87
Target Start/End: Complemental strand, 15739506 - 15739457
Alignment:
| Q |
37 |
tagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||| ||| |||||||||||| |
|
|
| T |
15739506 |
tagaataaaaatttatctttttt-cttatattttaggataaagaaaatgag |
15739457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 43 - 85
Target Start/End: Original strand, 37767214 - 37767256
Alignment:
| Q |
43 |
aaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
|||| ||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
37767214 |
aaaagtttgtcttttttacttataatttaggacaaagaaaatg |
37767256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 41 - 87
Target Start/End: Complemental strand, 44600404 - 44600358
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||||| || ||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
44600404 |
ataaaagttggtcttttttgcttatattttgagacaaagaaaatgag |
44600358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 54 - 87
Target Start/End: Complemental strand, 6190975 - 6190942
Alignment:
| Q |
54 |
ttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |
|
|
| T |
6190975 |
tttttttcttatattttgggacaaagaaaatgag |
6190942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 41 - 85
Target Start/End: Original strand, 25737813 - 25737857
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
|||||| ||| | |||||| ||||||||||||||||||||||||| |
|
|
| T |
25737813 |
ataaaagttttttttttttgcttatattttgggacaaagaaaatg |
25737857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 41 - 85
Target Start/End: Complemental strand, 35923226 - 35923182
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
|||||| ||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
35923226 |
ataaaagtttatctttttttattatattttgggacaaagaaaatg |
35923182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 46; Significance: 4e-17; HSPs: 35)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 35525579 - 35525493
Alignment:
| Q |
1 |
cttggaaaagagattttttnnnnnnncaataatacatagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
||||||||||||||||||| ||| | || |||| |||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35525579 |
cttggaaaagagattttttagaaaaacaagattaaataggataaaagtttgtcttttttacttatattttgggacaaagaaaatgag |
35525493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 36 - 87
Target Start/End: Original strand, 4047108 - 4047159
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4047108 |
atagaataaaagtttgtcttttttgcttatattttgggacaaagaaaatgag |
4047159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 36 - 84
Target Start/End: Original strand, 30576041 - 30576089
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaat |
84 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30576041 |
ataggataaaaatttgtcttttttgcttatattttgggacaaagaaaat |
30576089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 41 - 87
Target Start/End: Original strand, 24510883 - 24510929
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
24510883 |
ataaaaattggtctttttaacttatattttgggacaaagaaaatgag |
24510929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 41 - 87
Target Start/End: Original strand, 34890393 - 34890439
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34890393 |
ataaaagtttgtcttttttgcttatattttgggacaaagaaaatgag |
34890439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 41 - 85
Target Start/End: Original strand, 7022591 - 7022635
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7022591 |
ataaaagtttgtcttttttgcttatattttgggacaaagaaaatg |
7022635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 41 - 85
Target Start/End: Complemental strand, 7858500 - 7858456
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7858500 |
ataaaagtttgtcttttttgcttatattttgggacaaagaaaatg |
7858456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 41 - 87
Target Start/End: Original strand, 8107837 - 8107884
Alignment:
| Q |
41 |
ataaaaatttgtctttttta-cttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8107837 |
ataaaaatttgtctttttttgcttatattttgggacaaagaaaatgag |
8107884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 36 - 87
Target Start/End: Original strand, 13144175 - 13144226
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||| |||||| |||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
13144175 |
ataggataaaagtttgtcttttttgcttatattttgagacaaagaaaatgag |
13144226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 36 - 87
Target Start/End: Complemental strand, 24892784 - 24892733
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||| |||||| |||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
24892784 |
ataggataaaagtttgtcttttttgcttatattttggaacaaagaaaatgag |
24892733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 36 - 87
Target Start/End: Complemental strand, 36190717 - 36190666
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||| |||||| | |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36190717 |
ataggataaaagtgtgtcttttttgcttatattttgggacaaagaaaatgag |
36190666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 36 - 87
Target Start/End: Complemental strand, 36538025 - 36537974
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||| |||||| |||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
36538025 |
atagcataaaagtttgtcttttttgcttatattttgagacaaagaaaatgag |
36537974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 280 - 334
Target Start/End: Complemental strand, 7971070 - 7971016
Alignment:
| Q |
280 |
catggtgttgatgcaatccagattacgtaatccagacagcaccatcaccaattct |
334 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||| |||||||||| || ||||||| |
|
|
| T |
7971070 |
catggtgctgatgcaatccggattacgtaatccggacagcaccagcatcaattct |
7971016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 41 - 87
Target Start/End: Complemental strand, 13143705 - 13143659
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||||| ||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
13143705 |
ataaaagtttatcttttttgcttatattttgggacaaagaaaatgag |
13143659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 41 - 87
Target Start/End: Complemental strand, 17713183 - 17713137
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||||| || |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
17713183 |
ataaaagttggtcttttttacttataatttgggacaaagaaaatgag |
17713137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 280 - 334
Target Start/End: Original strand, 24627655 - 24627709
Alignment:
| Q |
280 |
catggtgttgatgcaatccagattacgtaatccagacagcaccatcaccaattct |
334 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||| |||| ||||| |||||||||| |
|
|
| T |
24627655 |
catggtgctgatgcaatccggattacgtaatccggacaacaccagcaccaattct |
24627709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 41 - 86
Target Start/End: Complemental strand, 8711817 - 8711772
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatga |
86 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||| ||||||| |
|
|
| T |
8711817 |
ataaaaatttgtcttttttatttatattttgagacaaataaaatga |
8711772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 43 - 84
Target Start/End: Original strand, 15958105 - 15958146
Alignment:
| Q |
43 |
aaaaatttgtcttttttacttatattttgggacaaagaaaat |
84 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
15958105 |
aaaaatttgtattttttgcttatattttgggacaaagaaaat |
15958146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 36 - 84
Target Start/End: Complemental strand, 7499671 - 7499623
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaat |
84 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
7499671 |
atagaatacaagtttgtcttttttacttatattttgggataaaggaaat |
7499623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 41 - 85
Target Start/End: Original strand, 26954592 - 26954636
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
|||||| || |||||||||||||||| |||||||||||||||||| |
|
|
| T |
26954592 |
ataaaatttggtcttttttacttataatttgggacaaagaaaatg |
26954636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 2 - 83
Target Start/End: Complemental strand, 28348591 - 28348511
Alignment:
| Q |
2 |
ttggaaaagagattttttnnnnnnncaataatacatagaataaaaatttgtcttttttacttatattttgggacaaagaaaa |
83 |
Q |
| |
|
|||||||||||||||||| ||| | || |||| |||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28348591 |
ttggaaaagagatttttttagaaaacaagattaaataggataaaagtttgtctttttt-cttatattttgggacaaagaaaa |
28348511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 280 - 332
Target Start/End: Original strand, 41530756 - 41530808
Alignment:
| Q |
280 |
catggtgttgatgcaatccagattacgtaatccagacagcaccatcaccaatt |
332 |
Q |
| |
|
||||||| || |||||||| ||||||||||||| |||| |||||||||||||| |
|
|
| T |
41530756 |
catggtgctgttgcaatccggattacgtaatccggacatcaccatcaccaatt |
41530808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 36 - 84
Target Start/End: Original strand, 41809017 - 41809065
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaat |
84 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||| |||||| ||||| |
|
|
| T |
41809017 |
atagaataaaagtttgtcttttttgcttatattttgagacaaaaaaaat |
41809065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 36 - 87
Target Start/End: Complemental strand, 11044024 - 11043973
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||| |||||| || ||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
11044024 |
atagcataaaagttggtcttttttgcttatattttgagacaaagaaaatgag |
11043973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 36 - 87
Target Start/End: Complemental strand, 16635406 - 16635355
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||| |||||| || |||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
16635406 |
atagcataaaagttggtctttcttacttatattttaggacaaagaaaatgag |
16635355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 36 - 87
Target Start/End: Complemental strand, 16635542 - 16635491
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||| |||||| || |||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
16635542 |
atagcataaaagttggtctttcttacttatattttaggacaaagaaaatgag |
16635491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 36 - 87
Target Start/End: Original strand, 24612674 - 24612725
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||| |||||| || ||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
24612674 |
atagcataaaagttggtcttttttgcttatattttgagacaaagaaaatgag |
24612725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 36 - 87
Target Start/End: Complemental strand, 35344333 - 35344282
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||| ||||||||| ||||||||| ||||||||||| ||||||||| ||||| |
|
|
| T |
35344333 |
atagcataaaaattggtcttttttgcttatattttgagacaaagaatatgag |
35344282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 36 - 86
Target Start/End: Original strand, 29920485 - 29920535
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatga |
86 |
Q |
| |
|
|||| |||||| ||||| |||||| ||||||||| |||||||||||||||| |
|
|
| T |
29920485 |
ataggataaaagtttgtgttttttgcttatatttagggacaaagaaaatga |
29920535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 41 - 85
Target Start/End: Original strand, 41086574 - 41086619
Alignment:
| Q |
41 |
ataaaaatttgtctttttta-cttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
41086574 |
ataaaagtttgtctttttttgcttatattttgggacaaagaaaatg |
41086619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 51 - 87
Target Start/End: Original strand, 2238791 - 2238827
Alignment:
| Q |
51 |
gtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
2238791 |
gtcttttttgcttatattttaggacaaagaaaatgag |
2238827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 41 - 85
Target Start/End: Complemental strand, 8673342 - 8673298
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
|||||| || ||||||||| |||||| |||||||||||||||||| |
|
|
| T |
8673342 |
ataaaagttggtcttttttgcttataatttgggacaaagaaaatg |
8673298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 41 - 85
Target Start/End: Complemental strand, 20051549 - 20051506
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
||||||||||||| ||||| |||||||||||| |||||||||||| |
|
|
| T |
20051549 |
ataaaaatttgtcgttttt-cttatattttggtacaaagaaaatg |
20051506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 36 - 84
Target Start/End: Original strand, 25321780 - 25321828
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaat |
84 |
Q |
| |
|
|||| |||||| || ||||||||| ||||||||||| |||||||||||| |
|
|
| T |
25321780 |
atagcataaaagttggtcttttttgcttatattttgagacaaagaaaat |
25321828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 54 - 86
Target Start/End: Original strand, 43216587 - 43216619
Alignment:
| Q |
54 |
ttttttacttatattttgggacaaagaaaatga |
86 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |
|
|
| T |
43216587 |
ttttttgcttatattttgggacaaagaaaatga |
43216619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 36 - 84
Target Start/End: Complemental strand, 157742 - 157694
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaat |
84 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
157742 |
atagaataaaagtttgtcttttttgcttatattttgggacaaagaaaat |
157694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0132 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 2)
Name: scaffold0132
Description:
Target: scaffold0132; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 36 - 86
Target Start/End: Complemental strand, 960 - 910
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatga |
86 |
Q |
| |
|
|||| |||||| |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
960 |
ataggataaaagtttgtcttttttgcttatattttgggacaaagaaaatga |
910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0132; HSP #2
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 36 - 86
Target Start/End: Complemental strand, 8920 - 8870
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaatga |
86 |
Q |
| |
|
|||| |||||| |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
8920 |
ataggataaaagtttgtcttttttgcttatattttgggacaaagaaaatga |
8870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 281 - 334
Target Start/End: Complemental strand, 205883 - 205830
Alignment:
| Q |
281 |
atggtgttgatgcaatccagattacgtaatccagacagcaccatcaccaattct |
334 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||||||| ||||| |||||||||| |
|
|
| T |
205883 |
atggtgttaatgcaatccggattacgtaatccagacatcaccagcaccaattct |
205830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0045 (Bit Score: 37; Significance: 0.000000000009; HSPs: 1)
Name: scaffold0045
Description:
Target: scaffold0045; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 41 - 85
Target Start/End: Complemental strand, 77931 - 77887
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
77931 |
ataaaagtttgtcttttttgcttatattttgggacaaagaaaatg |
77887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 37; Significance: 0.000000000009; HSPs: 7)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 41 - 85
Target Start/End: Original strand, 3095908 - 3095952
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3095908 |
ataaaagtttgtcttttttgcttatattttgggacaaagaaaatg |
3095952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 41 - 85
Target Start/End: Complemental strand, 21542392 - 21542348
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
21542392 |
ataaaagtttgtcttttttgcttatattttgggacaaagaaaatg |
21542348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 41 - 85
Target Start/End: Original strand, 34177828 - 34177872
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
34177828 |
ataaaagtttgtgttttttacttatattttggtacaaagaaaatg |
34177872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 41 - 85
Target Start/End: Original strand, 35129242 - 35129286
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
|||||| |||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
35129242 |
ataaaagtttgtcttttttgcttgtattttgggacaaagaaaatg |
35129286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 37 - 87
Target Start/End: Original strand, 1576870 - 1576919
Alignment:
| Q |
37 |
tagaataaaaatttgtcttttttacttatattttgggacaaagaaaatgag |
87 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||| ||| |||||||||||| |
|
|
| T |
1576870 |
tagaataaaaatttatctttttt-cttatattttaggataaagaaaatgag |
1576919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 36 - 82
Target Start/End: Complemental strand, 2851525 - 2851479
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaa |
82 |
Q |
| |
|
|||| |||||||||||||||||| | ||||| ||||||||||||||| |
|
|
| T |
2851525 |
ataggataaaaatttgtctttttcatttataatttgggacaaagaaa |
2851479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 36 - 84
Target Start/End: Complemental strand, 30949099 - 30949051
Alignment:
| Q |
36 |
atagaataaaaatttgtcttttttacttatattttgggacaaagaaaat |
84 |
Q |
| |
|
|||| |||||| || ||||||||| ||||||||||| |||||||||||| |
|
|
| T |
30949099 |
atagcataaaagttagtcttttttgcttatattttgagacaaagaaaat |
30949051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0442 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0442
Description:
Target: scaffold0442; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 41 - 81
Target Start/End: Complemental strand, 10019 - 9979
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaa |
81 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
10019 |
ataaaagtttgccttttttacttatattttgggacaaagaa |
9979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0018 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 41 - 84
Target Start/End: Complemental strand, 154835 - 154792
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaat |
84 |
Q |
| |
|
|||||| ||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
154835 |
ataaaagtttatcttttttacttatattttgagacaaagaaaat |
154792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0774 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0774
Description:
Target: scaffold0774; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 41 - 81
Target Start/End: Original strand, 3615 - 3655
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaa |
81 |
Q |
| |
|
|||||| ||| |||||||| ||||||||||||||||||||| |
|
|
| T |
3615 |
ataaaagtttatcttttttgcttatattttgggacaaagaa |
3655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0300 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0300
Description:
Target: scaffold0300; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 41 - 85
Target Start/End: Original strand, 760 - 804
Alignment:
| Q |
41 |
ataaaaatttgtcttttttacttatattttgggacaaagaaaatg |
85 |
Q |
| |
|
|||||| ||||| |||||| |||||||||||| |||||||||||| |
|
|
| T |
760 |
ataaaagtttgtgttttttgcttatattttggtacaaagaaaatg |
804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University