View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1841_low_39 (Length: 237)
Name: NF1841_low_39
Description: NF1841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1841_low_39 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 175; Significance: 2e-94; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 32924851 - 32925050
Alignment:
| Q |
1 |
cttatagtcttaatatgctcaaacttttattgttttagcttgtttcacaaagacagaggcaaacaagaggcagtactttgaaattgctaatagagtacac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32924851 |
cttatagtcttaatatgctcaaacttttattgttttagcttgtttcacaaatacaaaggcaaacaagaggcagtactttgaaattgctaatagagtacac |
32924950 |
T |
 |
| Q |
101 |
actcttacattttatgaaacattttcttaactgcatgcgtacaagtctagaagagattatctcagattacactgattttttaacttttcttttaaggtga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32924951 |
actcttacattttatgaaacattttcttaac----tgcgtacaagtctagaagagattatttcagattacactgattttttaacttttcttttaaggtga |
32925046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 32919531 - 32919621
Alignment:
| Q |
1 |
cttatagtcttaatatgctcaaacttttattgttttagcttgtttcacaaagacagaggcaaacaagaggcagtactttgaaattgctaat |
91 |
Q |
| |
|
|||| |||||| || || ||||||||||||||||| || |||||||||||||||| ||||||| ||| |||||| |||||||||||||||| |
|
|
| T |
32919531 |
cttacagtcttgatgtgttcaaacttttattgtttcagtttgtttcacaaagacaaaggcaaataaggggcagtgctttgaaattgctaat |
32919621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University