View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1841_low_43 (Length: 203)
Name: NF1841_low_43
Description: NF1841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1841_low_43 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 7e-79; HSPs: 8)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 1 - 157
Target Start/End: Original strand, 29998982 - 29999138
Alignment:
| Q |
1 |
tgtagcttctctgtccacagaaaaacgtgtacaccaacttggagttcttgatatcttcaacctcgttacttcagccaaaccaaaccatccattgtggtca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
29998982 |
tgtagcttctctgtccacagaaaaacgtgtacaccaacttggagttcttgatatcttcaacctcgttacttcagccaaaccaaatcattcattgtggtca |
29999081 |
T |
|
| Q |
101 |
tgtcttttgcagcaacaactatgctctatttccttctcttcactttcatataccttt |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29999082 |
tgtcttttgcagcaacaactatgctctatttccttctcttcactttcatataccttt |
29999138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 163 - 203
Target Start/End: Original strand, 29999422 - 29999462
Alignment:
| Q |
163 |
tggttctaaagggttgcctttttctgagtatggtccttatt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29999422 |
tggttctaaagggttgcctttttctgagtatggtccttatt |
29999462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 163 - 203
Target Start/End: Original strand, 29963113 - 29963153
Alignment:
| Q |
163 |
tggttctaaagggttgcctttttctgagtatggtccttatt |
203 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
29963113 |
tggttccaaagggttggctttttctgagtatggtccttatt |
29963153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 163 - 203
Target Start/End: Complemental strand, 30011685 - 30011645
Alignment:
| Q |
163 |
tggttctaaagggttgcctttttctgagtatggtccttatt |
203 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
30011685 |
tggttccaaagggttggctttttctgagtatggtccttatt |
30011645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 67 - 111
Target Start/End: Complemental strand, 30071501 - 30071457
Alignment:
| Q |
67 |
tacttcagccaaaccaaaccatccattgtggtcatgtcttttgca |
111 |
Q |
| |
|
|||||||||||||||||||||| |||||| | ||||||||||||| |
|
|
| T |
30071501 |
tacttcagccaaaccaaaccattcattgtagacatgtcttttgca |
30071457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 163 - 203
Target Start/End: Original strand, 29952008 - 29952048
Alignment:
| Q |
163 |
tggttctaaagggttgcctttttctgagtatggtccttatt |
203 |
Q |
| |
|
|||||| ||||||||| |||||||| ||||||||||||||| |
|
|
| T |
29952008 |
tggttccaaagggttggctttttctaagtatggtccttatt |
29952048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 67 - 111
Target Start/End: Original strand, 30005483 - 30005527
Alignment:
| Q |
67 |
tacttcagccaaaccaaaccatccattgtggtcatgtcttttgca |
111 |
Q |
| |
|
|||||||||||||||||| ||| |||||| | ||||||||||||| |
|
|
| T |
30005483 |
tacttcagccaaaccaaagcattcattgtagacatgtcttttgca |
30005527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 163 - 203
Target Start/End: Original strand, 30005860 - 30005900
Alignment:
| Q |
163 |
tggttctaaagggttgcctttttctgagtatggtccttatt |
203 |
Q |
| |
|
|||||| |||||| || |||||||||||||||||||||||| |
|
|
| T |
30005860 |
tggttccaaagggatggctttttctgagtatggtccttatt |
30005900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University