View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18420_low_2 (Length: 230)
Name: NF18420_low_2
Description: NF18420
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18420_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 39076221 - 39076443
Alignment:
| Q |
1 |
catttatgaaaaagtaaaacaagtgcaggttgaacaaaaagctttttcgattgcacgaacaaatatgaatttgtcttaacaagctaaatgcatggacatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39076221 |
catttatgaaaaagtaaaacaagtgcaggttgaacaaaaagctttttcgattgcacgaacaaatatgaatttgtcttaacaagctaaatgcatggacatt |
39076320 |
T |
 |
| Q |
101 |
aattgcttaactatataagtcttcattcagtgttttcttcgcataattgttgagctgcatatacttagtcaattaaatacaaattagtgcaagtaaatgt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
39076321 |
aattgcttaactatataagtcttcattcagtgttttcttcgcataattgttgagctgcatatacttagtcaattaaaaacaaattagtgcaagtaaatgt |
39076420 |
T |
 |
| Q |
201 |
ttagacaatgcaatgatgatgtc |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
39076421 |
ttagacaatgcaatgatgatgtc |
39076443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University