View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18421_high_21 (Length: 383)
Name: NF18421_high_21
Description: NF18421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18421_high_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 16 - 245
Target Start/End: Complemental strand, 48986915 - 48986686
Alignment:
| Q |
16 |
aattactctccattatgctgtttgtgtgatcaacacaatgaaaccttggatcatctttttaaagactctgaatgagtgaaattggtatgacttgatttaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
48986915 |
aattactctccattatgctgtttgtgtgatcaacacaatgaaaccttggatcatctttttaaagactctgaatgggtgaaattggtatgacttgatttaa |
48986816 |
T |
|
| Q |
116 |
ctcttggtgtcatctttgctgaaaacagagctggattggctctttcaggaactggattgagcaggtaattatgaaggaagaaatttaggtgattcaatgg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
48986815 |
ctcttggtgtcatctttgctgaaaacagagctggattggctctttcaggaactggattgagcaggtaattatgaatgaagaaatttaggtgattcaatgg |
48986716 |
T |
|
| Q |
216 |
gtctttgccattttctatgaggtttggagg |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
48986715 |
gtctttgccattttctatgaggtttggagg |
48986686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 121; E-Value: 7e-62
Query Start/End: Original strand, 246 - 366
Target Start/End: Complemental strand, 48986650 - 48986530
Alignment:
| Q |
246 |
tcccgatgccatgaccttccatcacaatgcaattagatcagtttggagttttgataatgcagctgatgtgctacataagatcagtttcgcatcaatacct |
345 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48986650 |
tcccgatgccatgaccttccatcacaatgcaattagatcagtttggagttttgataatgcagctgatgtgctacataagatcagtttcgcatcaatacct |
48986551 |
T |
|
| Q |
346 |
gtgccaaattgcaatgttcac |
366 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
48986550 |
gtgccaaattgcaatgttcac |
48986530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University