View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18421_high_25 (Length: 365)
Name: NF18421_high_25
Description: NF18421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18421_high_25 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 5e-84; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 5e-84
Query Start/End: Original strand, 18 - 175
Target Start/End: Original strand, 19822491 - 19822648
Alignment:
| Q |
18 |
taaagttgtgttagtttaacttatttcagcacatcaaatatatgtttttgtgcaacaatgatggtaaagttaagacttttgttgatggtaaatcccctct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19822491 |
taaagttgtgttagtttaacttatttcagcacatcaaatatatgtttttgtgcaacaatgatggtaaagttaagacttttgttgatggtaaatcccctct |
19822590 |
T |
|
| Q |
118 |
cttctttcttcaagcaatatgagctttttggtggagctgtgattatttaagtttaagg |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19822591 |
cttctttcttcaagcaatatgagctttttggtggagctgtgattatttaagtttaagg |
19822648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 197 - 357
Target Start/End: Original strand, 19823783 - 19823938
Alignment:
| Q |
197 |
tttgtcgtcgtgttcaatttctctccttttctgaacttgtattaataatatacaagatcaaccaaaaatatctcttgtccttgctcttagaagataccat |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||| ||||| || |
|
|
| T |
19823783 |
tttgtcgtcgtgttcaatttctctccttttctgaacttctattaataatatacaagatcaatcaaaaatatctcttgtccttgctctgagaag-----at |
19823877 |
T |
|
| Q |
297 |
accagtgaacaagaggttaggttttggtcatgtgaccttttccaaaagttattcctatgct |
357 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19823878 |
accagtgaacaagaggttaggttttggtcatgtgaccttttccaaaagttattcctatgct |
19823938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 168 - 201
Target Start/End: Complemental strand, 23189935 - 23189902
Alignment:
| Q |
168 |
gtttaaggtttagggtttagggtttagggtttgt |
201 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
23189935 |
gtttagggtttagggtttagggtttagggtttgt |
23189902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 168 - 201
Target Start/End: Complemental strand, 23611190 - 23611157
Alignment:
| Q |
168 |
gtttaaggtttagggtttagggtttagggtttgt |
201 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
23611190 |
gtttagggtttagggtttagggtttagggtttgt |
23611157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 163 - 199
Target Start/End: Complemental strand, 138 - 102
Alignment:
| Q |
163 |
tttaagtttaaggtttagggtttagggtttagggttt |
199 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
138 |
tttaggtttagggtttagggtttagggtttagggttt |
102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University