View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18421_high_26 (Length: 359)
Name: NF18421_high_26
Description: NF18421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18421_high_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 233; Significance: 1e-129; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 11 - 251
Target Start/End: Complemental strand, 36260251 - 36260011
Alignment:
| Q |
11 |
caaaggagagtgttgtttcttttgacaatatcaaaggagagaattaatgatgaattatgatttcttggtgttaatatcatgaattaataattcaagttga |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36260251 |
caaaggagagtgttgtttcttttgacaatatcaaaggagagagttaatgatgaattatgatttcttggtgttaatatcatgaattaataattcaagttga |
36260152 |
T |
 |
| Q |
111 |
aaatggctaacggacaatatgaaatggttaaatttgcaattgcccctggccttgagaagtattgaaggctcaactaactaactacccacctggccagcca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36260151 |
aaatggctaacggacaatatgaaatggttaaatttgcaattgcccctggccttgagaagtattgaaggctcaactaactaactacccacctggccagcca |
36260052 |
T |
 |
| Q |
211 |
tgtatacagataaatggaagcatcaaaggataccaaatatc |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
36260051 |
tgtatacagataaatggaagcatcaaaggatgccaaatatc |
36260011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 296 - 344
Target Start/End: Complemental strand, 36259966 - 36259918
Alignment:
| Q |
296 |
gaggtcatttggcgagtatattgagaccaggcctcgtcttcactttcat |
344 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36259966 |
gaggtcatttggcgagtatattgagaccaggcctcgtcttcactttcat |
36259918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University