View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18421_high_42 (Length: 255)
Name: NF18421_high_42
Description: NF18421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18421_high_42 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 16 - 239
Target Start/End: Original strand, 26130623 - 26130846
Alignment:
| Q |
16 |
aatatgttgaaactgtgaaaatataccacgtagacatttcgtggcattctgtaattttaagaagcattgatcttttcataatagaccgaaacatgacaaa |
115 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26130623 |
aatattttgaaactgtgaaaatataccacgtagacatttcgtggcattctgtcattttaagaagcattgatcttttcataatagaccgaaacatgacaaa |
26130722 |
T |
 |
| Q |
116 |
tatctcctttgtgaactgaatttctgccgatttctccagtgatcgcaaactagtctgcatcattggttgaccatattttgataggaaatcagatttaatt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26130723 |
tatctcctttgtgaactgaatttctgccgatttctccagtgatcgcaaactagtttgcatcattggttgaccatattttgataggaaatcagatttaatt |
26130822 |
T |
 |
| Q |
216 |
tccctaaaccgaaaatatgtaaga |
239 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
26130823 |
tccctaaaccgaaaatatgtaaga |
26130846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 239
Target Start/End: Complemental strand, 21428577 - 21428519
Alignment:
| Q |
181 |
gttgaccatattttgataggaaatcagatttaatttccctaaaccgaaaatatgtaaga |
239 |
Q |
| |
|
|||||||||| || || |||||||||||| ||||| ||||||||||||||| |||||| |
|
|
| T |
21428577 |
gttgaccatagttggaatggaaatcagattcaattttcctaaaccgaaaataggtaaga |
21428519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University