View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18421_high_46 (Length: 251)
Name: NF18421_high_46
Description: NF18421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18421_high_46 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 30 - 218
Target Start/End: Original strand, 20844816 - 20845004
Alignment:
| Q |
30 |
taagttaactcaggttggccataattgttgggtttgagcaattttgaaagagagaaaggcaatttccttacgacaattattgcttcaatgacattgtact |
129 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
20844816 |
taagttaactcacgttggccataattgttgggttttagcaattttgaaagagagaagggcaatttccttacgactactattgcttcaatgacattgtact |
20844915 |
T |
 |
| Q |
130 |
ctataaaggcctactctatgtaagatgctaaaataacattgtctcgttctatttaggttactcgaaggattcgaaagtcattcctgata |
218 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
20844916 |
ctataaacgcctactctatgcaagatgctaaaataacattgtctcgttctatttaggttactcgaaggatgtgaaagtcattcctgata |
20845004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University