View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18421_low_28 (Length: 359)

Name: NF18421_low_28
Description: NF18421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18421_low_28
NF18421_low_28
[»] chr8 (2 HSPs)
chr8 (11-251)||(36260011-36260251)
chr8 (296-344)||(36259918-36259966)


Alignment Details
Target: chr8 (Bit Score: 233; Significance: 1e-129; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 11 - 251
Target Start/End: Complemental strand, 36260251 - 36260011
Alignment:
11 caaaggagagtgttgtttcttttgacaatatcaaaggagagaattaatgatgaattatgatttcttggtgttaatatcatgaattaataattcaagttga 110  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36260251 caaaggagagtgttgtttcttttgacaatatcaaaggagagagttaatgatgaattatgatttcttggtgttaatatcatgaattaataattcaagttga 36260152  T
111 aaatggctaacggacaatatgaaatggttaaatttgcaattgcccctggccttgagaagtattgaaggctcaactaactaactacccacctggccagcca 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36260151 aaatggctaacggacaatatgaaatggttaaatttgcaattgcccctggccttgagaagtattgaaggctcaactaactaactacccacctggccagcca 36260052  T
211 tgtatacagataaatggaagcatcaaaggataccaaatatc 251  Q
    ||||||||||||||||||||||||||||||| |||||||||    
36260051 tgtatacagataaatggaagcatcaaaggatgccaaatatc 36260011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 296 - 344
Target Start/End: Complemental strand, 36259966 - 36259918
Alignment:
296 gaggtcatttggcgagtatattgagaccaggcctcgtcttcactttcat 344  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
36259966 gaggtcatttggcgagtatattgagaccaggcctcgtcttcactttcat 36259918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University