View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18421_low_48 (Length: 255)
Name: NF18421_low_48
Description: NF18421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18421_low_48 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 30 - 236
Target Start/End: Original strand, 35415681 - 35415887
Alignment:
| Q |
30 |
aacgaacccacctacaaatcagtgagtctgtttaagaaaacagacatactctcatgggttttagagaaaaccacaaacacgggaacaataccaaggcggt |
129 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
35415681 |
aacggacccacctacaaatcagtgagtctgtttaagaaaacagacatactctcatgggttttagagaaaaccacaaacacgggaacaataccaaggaggt |
35415780 |
T |
|
| Q |
130 |
gttgctggtgatgaacgacccagacgaccaccacaaaacccagatcaagcttcattgtggtctctgattggcgaacaacaagcagactacgaacgagaga |
229 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35415781 |
gttgctggtgatgaacgatccagaagaccaccacaaaacccagatcaagcttcattgtggtctctgattggcgaacaacaagcagactacgaacgagaga |
35415880 |
T |
|
| Q |
230 |
aactgga |
236 |
Q |
| |
|
||||||| |
|
|
| T |
35415881 |
aactgga |
35415887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University