View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18422_low_12 (Length: 257)
Name: NF18422_low_12
Description: NF18422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18422_low_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 9 - 146
Target Start/End: Complemental strand, 11850839 - 11850702
Alignment:
| Q |
9 |
agcacagataaaaattaacttgtaagaaaatccagtgtaattcattattcattagcaataaccaaacgttgccctatatgatattcaaagcctaaggaaa |
108 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
11850839 |
agcacaggtaaaaattaacttgtaagaaaatccagtgtaattcattattcattatcaataaccaaacgttgccctatatgatattcaaagcctaagaaaa |
11850740 |
T |
|
| Q |
109 |
ctcttgtttataatacatgttacaaaaataaattcaac |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11850739 |
ctcttgtttataatacatgttacaaaaataaattcaac |
11850702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 77 - 135
Target Start/End: Complemental strand, 11846016 - 11845958
Alignment:
| Q |
77 |
ttgccctatatgatattcaaagcctaaggaaactcttgtttataatacatgttacaaaa |
135 |
Q |
| |
|
|||| |||| |||||||||||| ||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
11846016 |
ttgcactatctgatattcaaaggctaagcaaactcttgtttataatacacgttacaaaa |
11845958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University