View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18422_low_13 (Length: 253)
Name: NF18422_low_13
Description: NF18422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18422_low_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 2 - 239
Target Start/End: Complemental strand, 30118370 - 30118133
Alignment:
| Q |
2 |
tcaccattaagggtaccattggaccttgctgagaggtggaacgaggaacgactaaactttggaaagacattagtgttccacacttcatgcataatgcaga |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30118370 |
tcaccattaagggtaccattggaccttgctgagaggtggaacgaggaacgactaaactttggaaagacattagtgttccacacttcatgcataatacaga |
30118271 |
T |
|
| Q |
102 |
cagggcagctgtagcgtgcaaggaattaattgctttttagattcaaaattaggtcttttgaggcaaaatacaatggaggaaacatgtatgaagtcacaca |
201 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30118270 |
cagggcggctgtagcgtgcaaggaattaattgctttttagattcaaaattaggtcttttgaggcaaaatacaatggaggaaacatgtatgaagtcacaca |
30118171 |
T |
|
| Q |
202 |
tgagagcattagtacacacaaggtgaaactctataacc |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30118170 |
tgagagcattagtacacacaaggtgaaactctataacc |
30118133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 93
Target Start/End: Complemental strand, 30132868 - 30132778
Alignment:
| Q |
1 |
ttcaccattaagggtaccattggaccttgctgagaggtggaacgaggaacgac-taaactttggaaagacattagtgttccacacttcatgcat |
93 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||| | ||||||| || |||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
30132868 |
ttcaccattaagggtaccatgggaccttgctgagagatgggaggaggaacaacttaaacttttgaaaga---tagtgttccacacttcatgcat |
30132778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University