View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18422_low_14 (Length: 252)
Name: NF18422_low_14
Description: NF18422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18422_low_14 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 141; Significance: 5e-74; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 70 - 252
Target Start/End: Complemental strand, 30118625 - 30118450
Alignment:
| Q |
70 |
tccactagttgtttgtctacattatctttgcttaattcaaccattgtacctcgagatgttgtccatgacggattctgtcagtcttcagcgaatctgaaac |
169 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30118625 |
tccactagttgtttgtctacattatttttgcttaattcaaccattgtacctcaagatgttgtccatgacggattctgtcagtcttcagcgaatctgaaac |
30118526 |
T |
 |
| Q |
170 |
ttttgcttcttaggcataactcataaggtagtgcttgacaacattgtaagaaaatcaagagctttaaatgaaagaaggagcct |
252 |
Q |
| |
|
| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
30118525 |
tattgcttcttaggc-------ataaggtagtgcttgacaacattgtaagaaaatcaagagctttaaaagaaagaaggagcct |
30118450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 194 - 244
Target Start/End: Complemental strand, 30133053 - 30133003
Alignment:
| Q |
194 |
aaggtagtgcttgacaacattgtaagaaaatcaagagctttaaatgaaaga |
244 |
Q |
| |
|
|||| ||| ||||||||||||||||| ||| ||||||||| |||||||||| |
|
|
| T |
30133053 |
aaggcagtacttgacaacattgtaagcaaaacaagagcttcaaatgaaaga |
30133003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University