View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18424_high_4 (Length: 258)
Name: NF18424_high_4
Description: NF18424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18424_high_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 21 - 241
Target Start/End: Original strand, 4830850 - 4831070
Alignment:
| Q |
21 |
tcttcatcaacttggatgtggaaccctaaacaacaccaagaacaagaagatgaagattcatgggaggtaagggcttttgctgaagacacaaggaatatta |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4830850 |
tcttcatcaacttggatgtggaaccctaaacaacaccaagaacaagaagatgaagattcatgggaggtaagggcttttgctgaagacacaaggaatatta |
4830949 |
T |
 |
| Q |
121 |
tgaacacaacatggccaccaaggtcctacacctgcaccttttgcagaagagagttccggtcagctcaagctcttggtggtcacatgaatgttcaccgccg |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4830950 |
tgaacacaacatggccaccaaggtcctacacctgtaccttttgcagaagagagttccggtcagctcaagctcttggtggtcacatgaatgttcaccgccg |
4831049 |
T |
 |
| Q |
221 |
cgaccgtgctcgtctccatca |
241 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
4831050 |
cgaccgtgctcgtctccatca |
4831070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 158 - 214
Target Start/End: Original strand, 34522611 - 34522667
Alignment:
| Q |
158 |
cttttgcagaagagagttccggtcagctcaagctcttggtggtcacatgaatgttca |
214 |
Q |
| |
|
|||||| | ||||||||| |||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
34522611 |
cttttgtaaaagagagtttaggtctgctcaagctcttggtggtcacatgaatattca |
34522667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 130 - 214
Target Start/End: Complemental strand, 31844623 - 31844539
Alignment:
| Q |
130 |
catggccaccaaggtcctacacctgcaccttttgcagaagagagttccggtcagctcaagctcttggtggtcacatgaatgttca |
214 |
Q |
| |
|
||||||||||||| || ||||| || | |||||| |||| |||||| ||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
31844623 |
catggccaccaagatcatacacatgtagcttttgtagaaaagagtttaaatcagctcaagcacttggaggtcacatgaatgttca |
31844539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University