View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18424_low_1 (Length: 585)
Name: NF18424_low_1
Description: NF18424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18424_low_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 2e-94; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 2e-94
Query Start/End: Original strand, 133 - 327
Target Start/End: Complemental strand, 2245279 - 2245084
Alignment:
| Q |
133 |
aatgtgtgtatgtatgggttgctgcaagtgataggataggtggggtgcatttatagttagcaacaa-gaagagcatagttgcttatcagacaacgaatcc |
231 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2245279 |
aatgtgtgaatgtatgggttgcagcaagtgataggataggtggggtgcatttatagttagcaacaaagaagagcatagttgcttatcagacaacgaatcc |
2245180 |
T |
 |
| Q |
232 |
cactccctattcacacgcacaactgggaaaacgtctcgattgtctttgtggattgacttaaatgactatagggtcctcgaccacgagacggttaat |
327 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2245179 |
cactccctattcacacgcacaactgggaaaacgtctcgattgtctttgtggattgacttaaatgactaaagggtcctcgaccacgagacggttaat |
2245084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 17 - 90
Target Start/End: Complemental strand, 2245386 - 2245314
Alignment:
| Q |
17 |
catccatgactatggtattaggaagaaggttacttnnnnnnnnttggtgccttctttatgagttagtgaaggtt |
90 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
2245386 |
catccatgactatggtattaggaagaaggttac-tgaaaaaaagtggtgccttctttatgagttagtgaaggtt |
2245314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 366 - 394
Target Start/End: Complemental strand, 2245041 - 2245013
Alignment:
| Q |
366 |
gtaacttgtttaatttgttcggttaaaca |
394 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2245041 |
gtaacttgtttaatttgttcggttaaaca |
2245013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University