View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18424_low_7 (Length: 272)
Name: NF18424_low_7
Description: NF18424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18424_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 30 - 122
Target Start/End: Complemental strand, 9247831 - 9247739
Alignment:
| Q |
30 |
ttcattacatgcattttgcaacataagaagaaacaaaattagtttgtcagatgtgtggctgcaatgacagattgtccttgattgatcacgagg |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9247831 |
ttcattacatgcattttgcaacataagaagaaacaaaattagtttgtcagatgcgtggctgcaatgacagattgtccttgattgatcatgagg |
9247739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 190 - 261
Target Start/End: Complemental strand, 9247671 - 9247600
Alignment:
| Q |
190 |
accgtctttaaatgatgcagtgtgaaggtgtttggagtttctgcaaagtcaatgcagtgttcttatgatgat |
261 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9247671 |
accgtctttaaatgatgcagtgtgaaggtatttggagtttctgcaaagtcaatgcagtgttcttatgatgat |
9247600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University