View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18425_low_22 (Length: 269)

Name: NF18425_low_22
Description: NF18425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18425_low_22
NF18425_low_22
[»] chr4 (1 HSPs)
chr4 (1-259)||(5957729-5957987)


Alignment Details
Target: chr4 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 1 - 259
Target Start/End: Original strand, 5957729 - 5957987
Alignment:
1 atatacaccgaatggaagatgttacaatggaagccgccggagtttgcgcgagcacctggtgggccaccgtcgaatgtggcggtggcccatgtcaggcttg 100  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
5957729 atatacacagaatggaagatgttacaatggaagccgccggagtttgcgcgagcacctggtgggccgccgtcgaatgtggcggtggcccatgtcaggcttg 5957828  T
101 gcggacgggcggctttgttggggaaagttggggaggatgagtttggggaggagattgttttggggatgaataaggagaaggtgcagactagaggggtgaa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5957829 gcggacgggcggctttgttggggaaagttggggaggatgagtttggggaggagattgttttggggatgaataaggagaaggtgcagactagaggggtgaa 5957928  T
201 gtttgattcggggtttcggactgggtgtagttatatgaaggtgaagtttgatgatgatg 259  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5957929 gtttgattcggggtttcggactgggtgtagttatatgaaggtgaagtttgatgatgatg 5957987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University