View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18425_low_29 (Length: 233)
Name: NF18425_low_29
Description: NF18425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18425_low_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 20703266 - 20703041
Alignment:
| Q |
1 |
ataagggtatgtttatttttctcttctgctccttttt--gagtaagctgaaatttatgtttttatggttaatgaaaagcttttttc-ttgttgaaatttt |
97 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||||| ||||||||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
20703266 |
ataagggtatgtttatttttctcttctgtccctttttttgagtatgctgaaatttatgtttttatggttaatgaaaagttttttttgttgttgaaattt- |
20703168 |
T |
 |
| Q |
98 |
ggagtaatgaaaatcaatttgtattttgtaggttgatagtgctaacaaacaaggaatacttcttgaagttgttcaaatcctcactgatctaaatctcatc |
197 |
Q |
| |
|
||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20703167 |
-gagtaatgaaagttaatttgtattttgtaggttgatagtgctaacaaacaaggaatacttcttgaagttgttcaaatcctcactgatctaaatctcatc |
20703069 |
T |
 |
| Q |
198 |
ataactaaagcttacatttcttctgatg |
225 |
Q |
| |
|
|||||||| ||||||||||||||||||| |
|
|
| T |
20703068 |
ataactaaggcttacatttcttctgatg |
20703041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University