View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18426_low_16 (Length: 290)
Name: NF18426_low_16
Description: NF18426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18426_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 110 - 271
Target Start/End: Original strand, 38706006 - 38706164
Alignment:
| Q |
110 |
ttcaacctgcaaaaatagacaacaacaaaattctattgtatttgtatatcctaaaccaattgtttaaaatttttaaatagaaaaggatggaaagtgaatg |
209 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38706006 |
ttcaacctgcaaaaatagacaa---caaaattctattgtatttgtatatcctaaaccaattgtttaaaaattttaaatagaaaaggatggaaagtgaatg |
38706102 |
T |
|
| Q |
210 |
ggtataccagaatatgggcatcgtttaattgttgatttgtgattagcttataaatttccttg |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38706103 |
ggtataccagaatatgggcatcgtttaattgctgatttgtgattagcttataaatttccttg |
38706164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 1 - 112
Target Start/End: Original strand, 38701853 - 38701964
Alignment:
| Q |
1 |
ttaaaatataccattgggattcaatgagataaaggtaattagcaactcgatcacataagtattcaatatactctagaacaacaatcaagtttctctgatc |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38701853 |
ttaaaatataccattgggatccaatgagataaaggtgattagcaactcgatcacaaaagtattcaatatactctagaacagcaatcaagtttctctgatc |
38701952 |
T |
|
| Q |
101 |
cataagacattc |
112 |
Q |
| |
|
|||||||||||| |
|
|
| T |
38701953 |
cataagacattc |
38701964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University