View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18426_low_18 (Length: 238)
Name: NF18426_low_18
Description: NF18426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18426_low_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 7 - 234
Target Start/End: Complemental strand, 40293860 - 40293633
Alignment:
| Q |
7 |
aagcagatagatataacttaaacaccattacaatcaaatttgatctaaactaatcgattgaggaggtgtagaagaaaacaattcaccatgatttgtgttg |
106 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40293860 |
aagcggatagatataacttaaacaccattacaatcaaatttgatctaaactaatcgattgaggaggtgtagaagaaaacaattcaccatgatttgtgttg |
40293761 |
T |
|
| Q |
107 |
tcagtttttgtaaaagctaaagtaaattatagtatgttacatgctagatagcaactattgttttagtccatgttcattttgagtatggagaagtgagtaa |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
40293760 |
tcagtttttgtaaaagctaaagtaaattatagtatgttacatgctagatagcaactattgttttagtccatgttcattttgagtatggagaagtgagcaa |
40293661 |
T |
|
| Q |
207 |
ggtaatatacatgaatggatttaatgat |
234 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
40293660 |
ggtaatatacatgaatggatttaatgat |
40293633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University