View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18428_low_5 (Length: 253)
Name: NF18428_low_5
Description: NF18428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18428_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 6 - 235
Target Start/End: Complemental strand, 45521475 - 45521246
Alignment:
| Q |
6 |
atggacatcatcattgttattatcatctatggaagagtctaccaacacaaccttatgatcattgttgttcaacaaatctttgactttgtcatagtaacat |
105 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45521475 |
atggacatgatcattgttattatcatctatggaagagtctaccaacacaaccttatgatcattgttgttcaacaaatctttgactttgtcatagtaacat |
45521376 |
T |
 |
| Q |
106 |
tgttgtgttatgataagcttggtgttggaggatattgcttgctttccaatctcagcagccgtgaagaaaggattggcggcagtggctacagcgccgagat |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
45521375 |
tgttgtgttatgataagcttggtgttggaggattttgcttgctttccaatctcagaagccgtgaagaaaggattggctgcagtggctacagcgccgagat |
45521276 |
T |
 |
| Q |
206 |
aagaagcaccaagaaaggagaagacgaatt |
235 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |
|
|
| T |
45521275 |
aagaagcagcaagaaaggagaagacgaatt |
45521246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University