View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18428_low_5 (Length: 253)

Name: NF18428_low_5
Description: NF18428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18428_low_5
NF18428_low_5
[»] chr2 (1 HSPs)
chr2 (6-235)||(45521246-45521475)


Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 6 - 235
Target Start/End: Complemental strand, 45521475 - 45521246
Alignment:
6 atggacatcatcattgttattatcatctatggaagagtctaccaacacaaccttatgatcattgttgttcaacaaatctttgactttgtcatagtaacat 105  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45521475 atggacatgatcattgttattatcatctatggaagagtctaccaacacaaccttatgatcattgttgttcaacaaatctttgactttgtcatagtaacat 45521376  T
106 tgttgtgttatgataagcttggtgttggaggatattgcttgctttccaatctcagcagccgtgaagaaaggattggcggcagtggctacagcgccgagat 205  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||    
45521375 tgttgtgttatgataagcttggtgttggaggattttgcttgctttccaatctcagaagccgtgaagaaaggattggctgcagtggctacagcgccgagat 45521276  T
206 aagaagcaccaagaaaggagaagacgaatt 235  Q
    |||||||| |||||||||||||||||||||    
45521275 aagaagcagcaagaaaggagaagacgaatt 45521246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University