View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18429_low_8 (Length: 250)
Name: NF18429_low_8
Description: NF18429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18429_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 53689039 - 53689239
Alignment:
| Q |
1 |
caatctacgccgactatatccgattccaatgtgggtgccgcacctggaattcctccgtccctaatggagaatactaggcactggcgtaccgcatcatctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
53689039 |
caatctacgccgactatatccgattccaatgtgggtgccgcacctggaattcctccgtccctaatggagaatactaggcactggcgtaccacatcatctc |
53689138 |
T |
|
| Q |
101 |
tattgtaataatttcttttacttgcagaaaaagaagtcccttcaaacttattcggtatttcttttttaattgaaattaggaaaggagattgaaaacataa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
53689139 |
tattgtaataatttcttttacttgcagaaaaagaagtcccttcaaacttattcagtatttcttttttaattgaaattaggaaaggagattgaaaacttaa |
53689238 |
T |
|
| Q |
201 |
t |
201 |
Q |
| |
|
| |
|
|
| T |
53689239 |
t |
53689239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 64
Target Start/End: Original strand, 53696101 - 53696164
Alignment:
| Q |
1 |
caatctacgccgactatatccgattccaatgtgggtgccgcacctggaattcctccgtccctaa |
64 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||| || ||||||||||||||||| |||||||| |
|
|
| T |
53696101 |
caatctacgccgactatattcgattccgatgtgtctgtcgcacctggaattcctctgtccctaa |
53696164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 201 - 242
Target Start/End: Original strand, 53693258 - 53693299
Alignment:
| Q |
201 |
taataatctaaacatagctaattgaaatatactagtataatc |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
53693258 |
taataatctaaacatagctaattgaaatatactagtgtaatc |
53693299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University