View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1842_high_19 (Length: 339)
Name: NF1842_high_19
Description: NF1842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1842_high_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 155; Significance: 3e-82; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 143 - 329
Target Start/End: Complemental strand, 1588716 - 1588529
Alignment:
| Q |
143 |
tattcttacgtattatttacatatatgatcttcacattgacggtggaatttgaactcagatctttgttagaagtggttgagttagcttaannnnnnn-gg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || |
|
|
| T |
1588716 |
tattcttacgtattatttacatatatgatcttcacattgacggtggaatttgaactcggatctttgttagaagtggttgagttagcttaattttttttgg |
1588617 |
T |
|
| Q |
242 |
ggatcgaatatatgtcttaattctaatctcgaatgaaatctttttatcagttggaaaaagtttcaaaattatttctctatactctctg |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1588616 |
ggatcgaatatatgtcttaattctaatctcgaatgaaatctttttatcagttggaaaaagtttcaaaattatttctctatactctctg |
1588529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 19 - 136
Target Start/End: Complemental strand, 1590596 - 1590479
Alignment:
| Q |
19 |
ttctatgcatattttagcaagtatacttattatatgacgatggaatcttttcaccagcgctgccttgctttataacatctccatgttaaataaaaagtct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
1590596 |
ttctatgcatattttagcaagtatacttattatatgacgatggaatcttttcaccagcgctgccttgctttataacatcttcacgttaaataaaaagtct |
1590497 |
T |
|
| Q |
119 |
caacctttaaggttattt |
136 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
1590496 |
caacctttaaggttattt |
1590479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University