View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1842_high_28 (Length: 250)
Name: NF1842_high_28
Description: NF1842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1842_high_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 134; Significance: 7e-70; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 66 - 240
Target Start/End: Complemental strand, 13845971 - 13845795
Alignment:
| Q |
66 |
atactttttgctgaaactattattcccatagtcacttgatgtatgttggttagtttgatacttttctgtagaactttataaatcattttggaaaactggt |
165 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
13845971 |
atactttttgctgaaactattattcctatagtcacttgttgtatgttggttagtttgatacttttctatagaactttataagtcattttggaaaactggt |
13845872 |
T |
 |
| Q |
166 |
ttcttgttaattttgggctgataaaactatcta--atttattatttttagttctttatcattgtaagctaacctatg |
240 |
Q |
| |
|
||||||||| ||||||||| |||||| |||||| |||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
13845871 |
ttcttgttatttttgggcttataaaagtatctattatttattatttttagttctttatcattgtaagctaaactatg |
13845795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 15 - 65
Target Start/End: Complemental strand, 13852528 - 13852478
Alignment:
| Q |
15 |
tttgtgtcctctgtatgagatttggtgatctctcaaaattcaatttattgt |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
13852528 |
tttgtgtcctctgtatgagatttggtgatctctcaaaattcaatatattgt |
13852478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 21 - 83
Target Start/End: Original strand, 9853120 - 9853182
Alignment:
| Q |
21 |
tcctctgtatgagatttggtgatctctcaaaattcaatttattgtatactttttgctgaaact |
83 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |||||||| |||||||| |||| |
|
|
| T |
9853120 |
tcctctgtatgagatttaatgatctctcaaaattcaattttttgtataccttttgctgcaact |
9853182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 16 - 74
Target Start/End: Original strand, 10666854 - 10666912
Alignment:
| Q |
16 |
ttgtgtcctctgtatgagatttggtgatctctcaaaattcaatttattgtatacttttt |
74 |
Q |
| |
|
|||||| |||||| |||||||||||||| ||||||||||||| |||| ||||||||||| |
|
|
| T |
10666854 |
ttgtgttctctgtgtgagatttggtgatttctcaaaattcaaattatggtatacttttt |
10666912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 83
Target Start/End: Original strand, 9842101 - 9842163
Alignment:
| Q |
21 |
tcctctgtatgagatttggtgatctctcaaaattcaatttattgtatactttttgctgaaact |
83 |
Q |
| |
|
||||||||||||||||| |||| ||||| || ||||||| |||||||| |||||||| |||| |
|
|
| T |
9842101 |
tcctctgtatgagatttaatgatatctcagaagtcaattttttgtataccttttgctgcaact |
9842163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University