View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1842_high_35 (Length: 214)
Name: NF1842_high_35
Description: NF1842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1842_high_35 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 17 - 201
Target Start/End: Complemental strand, 31848015 - 31847829
Alignment:
| Q |
17 |
aaaaatagcttaactggtctaaaactataaatattaggtaattacattaaattggggtttttt--acctggattaatttcaacataggttaataagtgtt |
114 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
31848015 |
aaaaataacttagctggtctaaaactataaatattaggtaattacattaaattggggttttttttacctggattaatttcaacataggttaataagtgtt |
31847916 |
T |
 |
| Q |
115 |
gcataatttatcaggaatttgatacttatcaacaaggtgatggtaaaatatgaaaaattcaaaattgcacgggtacatattcctttg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
31847915 |
gcataatttatcaggaatttgatacttatcaacaaggtcatggtaaaatatgaaaaattcaaaattgcacgggtacatatgcctttg |
31847829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University