View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1842_low_21 (Length: 333)
Name: NF1842_low_21
Description: NF1842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1842_low_21 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 34 - 333
Target Start/End: Original strand, 42753966 - 42754265
Alignment:
| Q |
34 |
ggcactaagcaaaagaggaaatagaatattcacataccccactaaaattgccttctcagcttttaataaatcaaagaaatgcaaggtagcaagcactgaa |
133 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42753966 |
ggcactaagcaaaacaggaaatagaatattcacataccccactaaaattgccttctcagcttttaataaatcaaagaaatgcaaggtagcaagcactgaa |
42754065 |
T |
 |
| Q |
134 |
aatgccatggagtatgcatttagaggttttgtgtctccatttccagaagttaagtttaccctcgatgtcaatccaaatgctggcctatcaaaagctaaaa |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
42754066 |
aatgccatggagtatgcatttagaggttttgtgtctccatttccagaagttaagtttaccctcgatgtcaatccaaacgctggcctatcaaaagctaaaa |
42754165 |
T |
 |
| Q |
234 |
cttttgaacacgtagcctcagccaatggcttcataacttgtttccaagagaaaactgaggctccgaatccatgtaacagaatcataggcaaacacagctt |
333 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42754166 |
cttttgaacacgtagcctcagccaatggcttcataacttgtttccaagagaaaactgaggctccgaatccatgtaacagaatcataggcaaacacagctt |
42754265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University