View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1842_low_34 (Length: 241)
Name: NF1842_low_34
Description: NF1842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1842_low_34 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 22306949 - 22307170
Alignment:
| Q |
1 |
acacatgaaaacggggactaaagttttttctaatatataaactcttttaaaattacgtggttgttcaatcagacctcgatcattattttggatatgtcgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||| |||||||||||||||||||| |||| |
|
|
| T |
22306949 |
acacatgaaaacggggactaaagttttttctaatatataaactcttttaaaattatgtggttgttctatcagacttcgatcattattttggatatatcgt |
22307048 |
T |
 |
| Q |
101 |
aatatgatttcagcattgctatacatcgcgaggtatattatcccaacggaatcacgacacctttgtcgtgaaaatttcactagtttatccgtcgggataa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
22307049 |
aatatgatttcagcattgctatacatcgcgaggcatattatcccaacggaatcacgacaccattgtcgtgaaaatttcgctagtttatccgtc-ggataa |
22307147 |
T |
 |
| Q |
201 |
ctaacattattcatatgatttat |
223 |
Q |
| |
|
||| ||||||||||||||||||| |
|
|
| T |
22307148 |
ctagcattattcatatgatttat |
22307170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 111 - 159
Target Start/End: Complemental strand, 12734763 - 12734715
Alignment:
| Q |
111 |
cagcattgctatacatcgcgaggtatattatcccaacggaatcacgaca |
159 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
12734763 |
cagctttgctatacatcgcgagacatattatcccgacggaatcacgaca |
12734715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 111 - 159
Target Start/End: Complemental strand, 12797590 - 12797542
Alignment:
| Q |
111 |
cagcattgctatacatcgcgaggtatattatcccaacggaatcacgaca |
159 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
12797590 |
cagctttgctatacatcgcgagacatattatcccgacggaatcacgaca |
12797542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 164 - 214
Target Start/End: Complemental strand, 51897572 - 51897522
Alignment:
| Q |
164 |
tgtcgtgaaaatttcactagtttatccgtcgggataactaacattattcat |
214 |
Q |
| |
|
||||||||||||||| |||| |||||| | |||||||||| |||||||||| |
|
|
| T |
51897572 |
tgtcgtgaaaatttcgctagcttatccattgggataactagcattattcat |
51897522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University