View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1842_low_39 (Length: 213)
Name: NF1842_low_39
Description: NF1842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1842_low_39 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 12 - 213
Target Start/End: Complemental strand, 2705593 - 2705392
Alignment:
| Q |
12 |
attatccaaacattggaggaaatgaaaccaacaaaaataagtacaagatggtagctagtnnnnnnntggttggagtattcataagtgtatggttaaaaga |
111 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2705593 |
attatcaaaacattggaggaaatgaaaccaacaaaaataagtacaagatggtagctagtaaaaaaatggttggagtattcataagtgtatggttaaaaga |
2705494 |
T |
|
| Q |
112 |
acaagtgttggaaaaatattgtgtttcaaatgtgagagtttgttcagttgcatgtggtgttatgggatatttaggaaacaaaggttgtgttggagttagt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2705493 |
acaagtgttggaaaaatattgtgtttcaaatgtgagagtttgttcagttgcatgtggtgttatgggatatttaggaaacaaaggttgtgttggagttagt |
2705394 |
T |
|
| Q |
212 |
at |
213 |
Q |
| |
|
|| |
|
|
| T |
2705393 |
at |
2705392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University