View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18430_high_8 (Length: 262)
Name: NF18430_high_8
Description: NF18430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18430_high_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 46 - 249
Target Start/End: Original strand, 36891322 - 36891525
Alignment:
| Q |
46 |
gctttattcctttgattgatgcttaactaactgatacatgatttaatgtgtcttcactgatacaacatcatagatatttgttccccaaaagggataataa |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36891322 |
gctttattcctttgattgatgcttaactaactgatacatgatttaatgtgtcttcactgatacaacatcatagatatttgttccccaaaagggataataa |
36891421 |
T |
|
| Q |
146 |
cttaacttgagcatgtaaaaagaaggaattagcttatgtcataagcttatatatatagcctttttgtaactttaggttattacatgaaatttgcatgtct |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36891422 |
cttaacttgagcatgtaaaaagaaggaattagcttatgtcataagcttatatatatagcctttttgtaactttaggttattacatgaaatttgcatgtct |
36891521 |
T |
|
| Q |
246 |
ctgc |
249 |
Q |
| |
|
|||| |
|
|
| T |
36891522 |
ctgc |
36891525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 130 - 163
Target Start/End: Original strand, 36899683 - 36899716
Alignment:
| Q |
130 |
ccaaaagggataataacttaacttgagcatgtaa |
163 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
36899683 |
ccaaatgggataataacttaacttgagcatgtaa |
36899716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University