View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18430_low_10 (Length: 271)
Name: NF18430_low_10
Description: NF18430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18430_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 153 - 253
Target Start/End: Complemental strand, 39996169 - 39996068
Alignment:
| Q |
153 |
cttgttattatcagtcaatcattttcaaagttttaaggtaatatcaaaattaattttaatctttaataatatattgcaaaagaatgaa-gtctcattcta |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
39996169 |
cttgttattatcagtcaatcattttcaaagttttaaggtaatatcaaaattaattttaatctttaataatatatcgcaaaagaatgaaggtctcattcta |
39996070 |
T |
 |
| Q |
252 |
gt |
253 |
Q |
| |
|
|| |
|
|
| T |
39996069 |
gt |
39996068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 1 - 81
Target Start/End: Complemental strand, 39996334 - 39996254
Alignment:
| Q |
1 |
tataaaattttaactagagaagatatattaattaccttgtcatattctactaaaacataacaaaaactcttaatagtatat |
81 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
39996334 |
tataaaattttaactagagaagatatattaattaccttgtcatattctactaaaacatagcaaaaactcttaatagtatat |
39996254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University