View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18431_high_15 (Length: 236)
Name: NF18431_high_15
Description: NF18431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18431_high_15 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 16 - 236
Target Start/End: Complemental strand, 46647308 - 46647088
Alignment:
| Q |
16 |
ctctcaacaccatattattattattccacatcatttttcaacactatttctttctccttcatgtaacccatcaccaccaacatcaaatctatggttccaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
46647308 |
ctctcaacaccatattattattattccacatcatttttcaacactatttctttctccttcatgtaacccaccaccaccaacatcaaatctatggttccaa |
46647209 |
T |
 |
| Q |
116 |
ttttgttctgtttagccatgtaatccaacgtccgaatttgattccgactttataatccattttaatgcttttaaactttttcttttgttctttgattcat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46647208 |
ttttgttctgtttagccatgtaatccaacgtccgaatttgattccgactttataatccattttaatgcttttaaactttttcttttgttctttgattcat |
46647109 |
T |
 |
| Q |
216 |
ttaatcaaatccaccgtcccc |
236 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
46647108 |
ttaatcaaatccaccgtcccc |
46647088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University