View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18433_high_17 (Length: 328)
Name: NF18433_high_17
Description: NF18433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18433_high_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 85; Significance: 2e-40; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 215 - 307
Target Start/End: Complemental strand, 31008734 - 31008642
Alignment:
| Q |
215 |
aaacttttgaagccaacaacatgcatttaacttccatgaaattaaaaacacataaaatatgaactaacaaaatattgacaaacataaagatac |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
31008734 |
aaacttttgaagccaacaacatgcatttaacttccatgaaattaaaaatacataaaatatgaactaataaaatattgacaaacataaagatac |
31008642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 102 - 143
Target Start/End: Complemental strand, 31008849 - 31008808
Alignment:
| Q |
102 |
ttaaactgtttacatatgaagttgaaagaacttactgccatt |
143 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
31008849 |
ttaaactgtttacatatgaagttgaaagtacttactgccatt |
31008808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University