View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18433_high_28 (Length: 264)

Name: NF18433_high_28
Description: NF18433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18433_high_28
NF18433_high_28
[»] chr4 (2 HSPs)
chr4 (16-102)||(22468135-22468221)
chr4 (152-232)||(22468007-22468084)


Alignment Details
Target: chr4 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 16 - 102
Target Start/End: Complemental strand, 22468221 - 22468135
Alignment:
16 acagaccctgagcttcaatattacagagaaagaacggcattaatgtcagtttcttttttggcaaataaattaatttcgatttcaggc 102  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
22468221 acagaccctgagcttcaatattacagagaaagaacggcattaatgtcagttacttttttggcaaataaattaatttcgatttcaggc 22468135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 152 - 232
Target Start/End: Complemental strand, 22468084 - 22468007
Alignment:
152 atttaggttcaacaaaataataatttttattttaaaaatgaagagcctaattaaattaatgcatacagaaaattaggaaga 232  Q
    ||||||||||||||||||||||||||  ||||||||| ||||||||||||||||||| |||||||||||||||||| ||||    
22468084 atttaggttcaacaaaataataattt--attttaaaa-tgaagagcctaattaaattcatgcatacagaaaattagtaaga 22468007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University