View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18433_low_15 (Length: 381)
Name: NF18433_low_15
Description: NF18433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18433_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 168; Significance: 6e-90; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 168; E-Value: 6e-90
Query Start/End: Original strand, 18 - 197
Target Start/End: Complemental strand, 33103148 - 33102969
Alignment:
| Q |
18 |
atatgaaggacatgacatgtttggttaccgtatagatatgcatatcatgccatgcggattgcaaagaaaaaccgtttggcctaatcggggagtatctgtt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33103148 |
atatgaaggacatgacatgtttggttaccgtatagatatgcatatcatgccatgcggattgcaaagaaaaaccgtttggcctaatcggggagtatctgtt |
33103049 |
T |
 |
| Q |
118 |
ttgctttttgttctgttataagccaaagactgcacaataaccacatatcatgttaaaataacatgactcacaacaaaata |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
33103048 |
ttgctttttgttctgttataagccaaagactgcacaatgacctcatatcatgttaaaataacatgactcacaataaaata |
33102969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University