View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18433_low_26 (Length: 288)
Name: NF18433_low_26
Description: NF18433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18433_low_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 5e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 79 - 272
Target Start/End: Complemental strand, 33751324 - 33751131
Alignment:
| Q |
79 |
ttatattcttatccttattaaaaaacaatgtactcattgaagctgaatatataaccctttaagctaaaaagacaaaatcagtgaacagaactagtattta |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33751324 |
ttatattcttatccttattaaaaaacaatgcactcattgaagctgaatatataaccctttaagctaaaaagacaaaatcagtgaacagaactagtattta |
33751225 |
T |
 |
| Q |
179 |
tactataatataattcaacaaagccacacattaagtagaatattttagaaagcagattacattaaaatcacgatttgcacttgcaggtatatat |
272 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33751224 |
tactataatataattcaataaagccacacattaagtacaatattttagaaagcagattacattaaaatcacgatttgcagttgcaggtatatat |
33751131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 240 - 268
Target Start/End: Complemental strand, 32576023 - 32575995
Alignment:
| Q |
240 |
ttaaaatcacgatttgcacttgcaggtat |
268 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
32576023 |
ttaaaatcacgatttgcacttgcaggtat |
32575995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University